PCR technieken. Op zoek naar twee resisteniegenen van Solanum

advertisement
PCR technieken. Op zoek naar twee
resisteniegenen van Solanum
Tuberosum, 4 +2 rassen.
______________________________________________________________
Klas 11A/B/C periode biologie, Rudolf Steinercollege, Haarlem december 2014.
onder begeleiding van M. Hogewoning, B.v. Zweeden.
SAMENVATTING
Bij planten van de familie Solanum is bekend dat zij beschikken over zogenaamde
resistentiegenen tegen Phytophtora Infestans. Deze genen die in hedendaagse cultivars van
aardappelen lijken te zijn verdwenen, zijn nog volop aanwezig in wilde aardappelplanten en
planten van de nachtschadefamilie.
In dit practicum, uitgevoerd door klas11 van het Rudolf Steiner College, Haarlem, worden zes
aardappelrassen getest op de aanwezigheid van twee resistentiegenen. Daarnaast worden deze
uitkomsten vergeleken met de claims van de leverancier van de (poot)aardappelen. Door
bederf van de in de vriezer geconserveerde bladeren van Solanum, bleken bederf een
verstorende factor van belang. Opvallend was dat de verse groenten soms wel response gaven.
INLEIDING
In dit practicum wordt onderzocht of de in
de zes rassen (Melody, CERISA, Agata,
Meerlander en Tomaat en Aubergine) de
Resistentiegenen R1 en R3a aanwezig zijn.
Het resistentie gen R3a is terug te vinden
in de ncbi-database m.b.v URL:
http://www.ncbi.nlm.nih.gov/nuccore/AY8
49382.1 . Resistentiegen R1 wordt
genoemd in een voor scholen ontwikkeld
practicum door de WUR, Wageningen.
Helaas vermeldde men niet de herkomst
van de gebruikte primers.
De leerlingen zijn in dit practicum op zoek
naar de aanwezigheid van deze twee
genen.
METHODEN EN TECHNIEKEN
In dit practicum werd gebruik gemaakt van
de Phire-Plant PCR-mix, code F130.
Hierbij werden 2-3 mm2 grootte samples
van het bladmateriaal van de aardappels in
tabel 1.0 en gecrushd met een losse Finntip in een oplossing van 20 uL DilutionBuffer. Nadat deze buffer min 1 minuut
had ingewerkt, werden deze gevortexted en
bij 15000 rpm gecentrifugeerd.
Van deze samples is 0,6 uL overgenomen
in een nieuw 0.2ml ep waarin
achtereenvolgens is toegevoegd: 8 uL
Dnase-vrij water, 10 uL PCR-buffer
(dNTP's, MgCl2), 0.6 ul DNA-Taqpolymerase en 0,6 uL primeroplossing A
en B (Zie tabel 2.0)
Na opnieuw vortexen en centrifugeren
werden de samples in de PCR-machine
gedaan (Techne Cyclo-gene 9600) en
gerund volgens het protocol opgesteld in
tabel 3.0.
Hierna werd van elk monster 15 uL
genomen en onder toevoeging van 6 uL
loading dye (R631) geladen in een 2%
agarose gel onder toevoeging van 0.6 uL
EtBr opdat het DNA met UV-licht te
detecteren is.
Als controle voor de werkzaamheid is ook
een sample genomen van Afrikaan, onder
toevoeging van de door Phire-Plant
geleverde control-primer die voor
amplificatie zorgt van het chloroplast
DNA.
Aardappelras/
Plantensoort
MELODY
CERISA
AGATA
MEERLANDER
Resistent volgens
leverancier
Aubergine
Tomaat
Tabel 1.0. Gebruikte aardappelrassen en plantensoorten.
Locus
R1F2
Locus
R1-A
Primer
GAGTCGGTTGTCAAGTCAG
Tm*
51.1
Tm
R1R2
R1-B
GCATATCTTCCGCATCAGT
50.6
R3aF2
R3-A
AGATTGTTGGTGGTGAGAAT
50.1
56
R3aR2
R3-B
AGGAAGTGATTGGAGATTAGG
50.2
56
Alleles
size
269
Genbankno
269
JN609619.1
1
293 bp
AY849382.1
1
293 bp
AY849382.1
JN609619.1
Tabel 2.0, NieuwePrimers gebruikt in dit practicum vastgesteld met Primer Premier v 6.0 (okt 2014)
RESULTATEN
De resultaten zijn gegroepeerd rond de runs van de electroforese. Hierbij is gebruik gemaakt
van de lettercodering van de leerlingen. Voor de controle extra bepaling uitgevoerd met
primer R3a op Tomaat alsmede een Control-primer op Tomaat.
Uit tabel 3 blijkt wat de uitkomst was van deze test. Foto's van de gel-electroforese, zie figuur
1.
Wie
code
Getest RAS/Groente
R3a amplicon
R1 amplicon
Pepijn/Kjell
A
niet genoteerd??
?
?
Amin/Riemer
B
MELODY
George/Thijs
C
CERISA
Steven/Lev
D
AGATA
geen R1-gen
Geen R3a-gen
Geen R1-gen
Heel byzonder!!!
drie fragmenten!!!!
Aanwezigheid R3a
gen
Donne/Mabel
Z
AUBERGINE
Cecile/Maud
F
CERISA
Kim/Sanne/Giuliette
G
AUBERGINE
Daan/Lucas vH
H
MEERLANDER
Tobias/Femke
K
AGATA
Wilmar/Ilsa
L
MEERLANDER
Mark/Tom
M
TOMAAT
Lucas/Bouwewijn
P
TOMAAT
Gen R3a aanwezig
Sam/Kamiel
Q
niet genoteerd??
300 bp fragment
Tijn/Jesse
S
AUBERGINE
Bart
Tomaat-controle
Bart
Tomaar r#a
Tabel 3.0 Groepen leerlingen en hun plant-keuzen + resultaten
Geen R1-gen
Geen R3a gen
Geen R1-gen
?
?
Vreemde uitslag. (T3a
300 bp fragment???
DNA smear.
300 bp fragment.
293 bp fragment.
FOTO-MATERIAAL AGAROSE-GEL
Uit deze resultaten blijkt dat
Lane A:
Geen resultaten
Lane B:
idem
Lane C:
Idem
Lane D:
Idem
Lane Z:
drie fragmenten. op ca 270,350 en 400
Lane F:
Twee fragmenten op ca 380, ca 300
Lane G
Geen resultaten
Lane H:
Geen resultaten
Lane K:
Geen resultaten
Lane L:
Geen resultaten
Lane M:
DNA-Smear. Gaat iets mis met primers?
Lane P:
Fragment op 300-350
Lane Q:
Fragment op 300-350
Lane S:
DNA-Smear. Gaat iets mis met primers?
Lane Tc:
Tomaat Control. PCR werkt wel.
Lane T:R3a: fragment rond de 300 bp.
CONCLUSIE
Op basis van deze experimenten die nu gehouden zijn valt op dat enkele lanes erg duidelijk
zijn: (Z, F, P, en Q). Tomaat R3a wasbij mj al bekend dat ie werkt. Dus in lane P is 100%
zeker goed. Ook lane van Mark en Tom klopt uit eerdere metingen: het R1-gen ontbreekt in
Tomaat!
De analyse van de overige lanes neem ik voor kennisgeving aan: er is nog niet eerder
onderzoek aan gedaan. Dus volgend jaar kunnen we nog eens analyseren.
Bijlage 1. Protocollen
Gevolgd Protocol:
1.
Het maken van de gel:
1.
25 ml 10X TBE buffer
2.
Voeg toe tot 250 ml met auqadest
3.
Hiervan 80 ml genomen voor de gel. Toevoegen 1,6 gr agarose (2%)
4.
45 sec magnetron -> swirl -> 45sec magn. -> swirl-> 30 sec magn.
5.
Cool down
6.
6 uL EtBr erbij (vanuit 1% flesje)
7.
Zijkantjes goed vastzetten en gel gieten bij net niet pijn-temperatuur.
Geen bellen!
8.
Als de zaak gestold is: Overgieten met de rest van de buffer.
Totaal zit erin de bak 300-350 ml TBE buffer.
3.
DILUTED: Per sample-materiaal:
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
13.
13.
4.
5.
0.2 epje
20 uL Dilutionbuffer
Crush 2 mm2 met pipetpunt.
vortex kort 10 sec
centrifuge 30 sec
Laat even staan 2 min.
Neem 0.6 uL supernatant.
0.2 epje
10 uL PCR buffer
0.6 uL primer A en 0.6uL primer B
0.6 uL Polymerase
voeg die 0.5 uL supernatant toe.
Vul met water aan tot 20 uL
vortex en centrifugeer beide kort ca 20 sec.
Laat 5 min staan.
PCR programma 40:
fase 1:
15 min 98 oC
fase 2:
30 sec 98 oC
30 sec 51 oC (Volgens literatuur)
60 sec 72 oC
herhaal hierna nog 39 X
fase 3:
5 min op 72 oC
DNA 50 bp Ladder:
1.
Neem 0.2 ml epje
2.
Voeg 3.0 uL DNA-ladder toe
3.
Voeg 3.0 uL Loading dye toe #R0631
4.
Voeg nog 12 ml H2O toe. Samen 18 uL Is meer dan genoeg voor één gel.
6.
Gel electroforese
1.
Nadat de PCR klaar is, wordt van de epjes 1 tm 8 15 uL genomen en toevoegen 5 uL loading dye. Vortex en
centrifuge kort.
Laden van 20 uL van elk monster in de gel:
2.
Download
Random flashcards
fff

2 Cards Rick Jimenez

mij droom land

4 Cards Lisandro Kurasaki DLuffy

Create flashcards