BioBrick Prefix

Tutorial BioBricks
Jan Mertens
Elke Van Assche
BioBrick: definitie

Het part zelf begint met eerste letter (A, C, T, G) die
volgt op de prefix cloning site van het plasmide en
eindigt met de laatste letter voor de suffix cloning site
van het plasmide
 Part sequentie in de registry: start met de eerste base van het
part en eindigt met de laatste base
 Vb. Start met ATG en eindigt met TAATAA
 Exclusief prefix en suffix



Prefix en suffix liggen op plasmide waarin het part zit
Prefix en suffix hebben knipplaatsen voor EcoRI, XbaI,
SpeI, PstI
BioBrick heeft dus geen knipplaatsen voor restrictieenzymen
Prefix en suffix

BioBrick Prefix

Als het part dat volgt een coderende sequentie is of een ander part dat
start met "ATG", dan is de BioBrick prefix :
gaattcgcggccgcttctag
 Anders is de BioBrick prefix :
gaattcgcggccgcttctagag

BioBrick Suffix


De standaard BioBrick suffix is :
tactagtagcggccgctgcag
BioBrick Scar

Als BioBricks met deze prefix and suffix sequenties geassembleerd
worden is er een "scar“ tussen de parts.
 Als het tweede part met "AT“ begint, is de scar
tactag
 Anders is de scar
tactagag
Soorten Biobricks

Basic Parts


Basic Parts zijn atomische eenheden van DNA
De oorsprong is de-novo synthese, genbank, primer extension en PCR,
of andere technieken
 Zoals alle parts wordt ook een Basic part gehouden in een plasmide
 In het plasmide is het omgeven door een restrictie-enzym cloning
region, maar de cloning region is geen onderdeel van de sequentie

Composite Parts

Composite Parts zijn functionele eenheden gevormd door een
geordende serie Basic of Composite parts
 De sequentie zit niet in de registry
 Functie en design worden wel gedocumenteerd
Soorten BioBricks (vervolg)

Construction Intermediates



Construction Intermediates hebben geen specifieke functie
Resultaat van de assembly van twee parts
Geen documentatie nodig
 Naam van part is dan: 'BBa_Snnnnn‘, automatisch toegewezen door
registry software
Biobrick nomenclature
Zoeken van BioBrick per type
Voorbeeld inverters
Tabellen met parts
Letter code definities
Plasmiden

Plasmide backbone



Plasmide backbone: elk part wordt
gezet op een plasmide
Dit bevat de prefix en suffix en een
antibioticumresistentiegen voor
selectie
Construction plasmide


Het ccdB toxic gen verzekert dat
cellen getransformeerd met niet
geknipte of gereligeerde plasmiden
niet groeien
Gevormde kolonies zijn waarschijnlijk
juist geligeerd
Plasmiden (vervolg)

Plasmide met biobrick parts

Structuur van een plasmide:
ori, ab-resistentie en
cloningsite
Plasmiden: nomenclatuur
ori
versienummer
pSB#X#
plasmid
Synthetic
Biology
Ab-resistentiemerker
Number
Replication origin
Copy number
Purpose
1
modified pMB1 derived
from pUC19
500-700
Easy plasmid DNA
purification
2
F and P1 lytic derived from
pSCANS-1-BNL
1-2 inducible to
high copy
Inducible copy number
3
p15A derived from pMR101 10-12
Multi-plasmid
engineered systems
4
rep101, repA derived from
pSC101
~5
Small cell to cell copy
number variation
5
derived from F plasmid
1-2
Improved plasmid
stability
6
pMB1 derived from
pBR322
15-20
Multi-plasmid
engineered systems
Code
Antibiotic
A
ampicillin
C
chloramphenicol
E
erythromycin
G
gentamycin
K
kanamycin
N
neomycin
Na
nalidixic acid
R
rifampicin
S
spectinomycin
St
streptomycin
T
tetracycline
Tm
trimethoprim
Z
zeocin
Zoeken naar plasmiden
Restrictie-enzymen en
knipplaatsen

Restrictie op herkenningssequentie
 Enzyme EcoRI
 Herkent GAATTC en knipt tussen G en de A op
beide strengen.
 Sticky ends: AATT
 Gebruikt voor verplaatsing van stuk DNA van
ene plasmide naar andere





Knippen uit ene plasmide
Andere plasmide openknippen met zelfde
enzyme
Zuiveren (enzyme werkt niet optimaal,
steractiviteit)
De sticky ends annealen via baseparing
(complementair).
Na ligatie is de originele restrictiesite hersteld
Restrictie-enzymen en
knipplaatsen (vervolg)
 SpeI - XbaI (Mixed Sites)
 Deze twee enzymes hebben compatible sticky
ends maar incompatible recognition sequences
 Dezelfde sticky ends worden verkregen, CTAG
 Na ligation vormt de resulterende sequentie
geen knipplaats voor XbaI noch voor SpeI
= mixed site.

4 restrictie-enzymen (XbaI, SpeI, EcoRI, PstI)
zijn voldoende voor alle DNA manipulaties

Biobrick parts zelf mogen deze
herkenningssequenties niet bevatten.
Biobrick assembly

Standard assembly






EcoRI and XbaI knipplaatsen
links and SpeI and PstI rechts
Knippen van het fragment
(blauw) met EcoRI en SpeI
Knippen van plasmide met
groen fragment met EcoRI en
XbaI
Zuivering m.b.v.
gelelektroforese
Ligatie: E-sticky ends met
elkaar, S en X
Transformatie naar E.coli en
expressie van het construct
Biobrick assembly (vervolg)

Parallel assembly

Standard assembly duurt te lang als je
verschillende parts aan elkaar wilt lassen
 Oplossing: parallel

Rolling assembly

Als assembly van 2 parts faalt, zal dit zich in een
later stadium oplossen
Ribosoombindingssites (RBS)

Verschillende RBS
binden ribosomen met
verschillende efficiëntie


Opm. Hoewel dit de
globale efficiëntie niet
direct bepaalt is dit toch
een belangrijke variabele
Standaard assembly: De
RBS zit fysisch nabij het
startcodon (Bij BioBricks
is dit altijd ATG.)
Protocol voor gebruik Biobricks



“The Spring 2008 Distribution binder” bevat alle parts uit
de registry
Het DNA voor alle parts is geïsoleerd en gespot op een
filterpapier
Extensieve kwaliteitscontrole
Kwaliteitscontrole

Bekijken van platen



In de registry DNA repositories
Spring 2008
Bevat alle platen van 2008 Spring DNA Distribution
Bekijken van kwaliteitscontrole van elk part
Protocol voor gebruik Biobricks

Lokaliseren van een part in de distributie




Nummer intikken in search box
Klikken op Physical DNA
Alle lokaties van een bepaald part
Enkel Physical DNA voor parts die Available zijn
Protocol voor gebruik Biobricks

Paper Punches


Geschatte duur: 1 minuut per spot
Nodige materialen:





TE (10:1, pH 8.0) = tris(hydroxymethyl)aminomethane en EDTA
Desired spot location information
Olfa cutting materiaal (back of binder)
Punch tool
1.5ml PCR tubes
Protocol voor gebruik Biobricks

Paper Punches

Werkwijze






Warm up 5 μl aliquots of TE buffer to 50ºC in 1.5 ml (PCR) Eppendorf tubes.
Warm a water bath to 42 degrees.
Slide the cutting mat under the page in the binder containing the DNA of
your part.
Using the punch tool, press down firmly on the spot you want to punch out
while rotating the punch tool BUT NOT while pressing the ejector plunger
(see the instructions on the punch tool wrapper). The spot is large enough to
allow several punches, so punch at the edge of the spot.
Eject the punched paper spot into the tube containing 5 µL of TE buffer by
pressing down on the top part of the punch tool.
Spin the tubes containing filter paper spot and TE for ~3 minutes at 15,000 x
g.
Be sure to clean the punch tool before punching out another spot, to prevent
cross-contamination of parts.
Protocol voor gebruik Biobricks

Punch Tool Cleaning


Geschatte duur: 5 minuten per spot
Nodige materialen:




Blotting paper (back of binder)
10% bleach
diH2O
95% ethanol
Protocol voor gebruik Biobricks

Punch Tool Cleaning

Werkwijze



Punch a blank sheet of blotting paper and remove the punched paper. Pull
the punch tool apart, so that the black rod is separated from the column.
Dip both the rod and the column briefly into a series of solutions of 10%
bleach, distilled water, a second bath of distilled water, and a final bath of
95% ethanol.
Opm: We have found that strong detergents tend to remain on the punch
tool and can inhibit transformation of the DNA. Ethanol is preferred over
isopropanol for the final cleaning bath, as it dries much faster.
Blot with a Kimwipe (= opkuisdoekje) and allow to dry for 5 minutes. Note
that the ethanol can wick up inside the column of the punch tool. It is
important that the punch tool be completely dry before punching out another
DNA spot, as the ethanol will affect the transformation efficiency.
Protocol voor gebruik Biobricks

Transformatie


Geschatte duur: 3 uur (plus 12-14 uur incubation)
Materials needed:







Spots soaked in TE
2.0ml conical bottom tubes (one per spot)
Ice
Competent cells
42º water bath / 37º incubator
SOC (check for contamination!)
Petri plates with appropriate antibiotic
Protocol voor gebruik Biobricks

Transformatie

Werkwijze




Soak the spots in 5 µL of the warmed TE for 20 minutes. This allows the
maximum concentration of DNA in solution. Start thawing the competent
cells on wet crushed ice.
Chill labeled 2 ml conical bottom tubes on wet ice. Add 2 µL of DNA in TE
and 50 µL of thawed TOP10 competent cells to the tubes. In our experience,
these volumes have the best transformation efficiency. The 2 ml tubes allow
better liquid movement during incubation. Extra eluted DNA may be held at
least several weeks frozen or at refrigerator temperature.
Hold the DNA and competent cells on ice for 30 minutes. This improves
transformation efficiency by a significant amount.
Heat shock the cells by immersion in a pre-heated water bath at 42ºC for 60
seconds. A water bath is important to improve heat transfer to the cells.
Protocol voor gebruik Biobricks

Transformatie

Werkwijze (vervolg)





Incubate the cells on ice for 2 minutes.
Add 200 μl of SOC broth (check that this broth is not turbid, which would
indicate previous contamination and bacterial growth). This broth should
contain no antibiotics.
Incubate the cells at 37ºC for 2 hours while the tubes are rotating or shaking.
We have found that growth for 2 hours helps in transformation efficiency,
especially for plasmids with antibiotic resistance other than ampicillin.
Label an LB agar plate containing the appropriate antibiotic(s) with the part
number, plasmid, and antibiotic resistance. Plate 250 µl of the incubated cell
culture on the plate.
Incubate the plate at 37ºC for 12-14 hours, making sure the agar side of the
plate is up. If incubated for too long the antibiotics, especially ampicillin, start
to break down and un-transformed cells will begin to grow.
Protocol voor gebruik Biobricks

Transformatie

Opmerkingen

Bij problemen: testen competente cel efficiëntie
http://www.openwetware.org/wiki/TOP10_chemically_competent_cells


Plasmide DNA verdunnen tot 10 pg/ul plasmide DNA in TE
Efficientie van 108 cfu/ug is goed
Protocol voor gebruik Biobricks

Making your own Glycerol Stock


Geschatte duur: ~1 hour (after overnight incubation of single
colony liquid culture)
Nodige materialen:






Single E. coli colony of transformed part
LB broth with appropriate antibiotic
15ml tubes
Cryotubes (see below)
80% glycerol
Label with appropriate information
Protocol voor gebruik Biobricks

Making your own Glycerol Stock

Werkwijze







Pick a single colony from the above plate into 10 ml of LB broth with
appropriate antibiotic and grow 12-14 hours to create an overnight liquid
culture.
Combine 1 ml of overnight culture and 150 μl of a sterile 80% glycerol
solution in a screw-top cryotube.
Vortex briefly.
Incubate at room temperature for 1/2 hour, and place directly into a –80
degree freezer.
Prior to freezing, label the tube with the Biobrick part number, plasmid, and
antibiotic resistance.
Glycerol stocks may be used for future access to the part by scraping small
amounts of frozen culture from the tube without thawing. The culture can be
plated or used directly to infect a liquid culture. Plates containing
transformed parts may be held in plastic bags at refrigerator temperature for
at least two weeks.
The overnight culture can be used to prepare plasmid DNA with any
standard miniprep. We have had good luck with the Qiagen miniprep kits.
Protocol voor gebruik Biobricks

Antibiotica

Ampicillin: 100mg/ml stock solution (add 1ml/L medium)


Kanamycin: 50mg/ml stock solution (add 1ml/L medium)
Chloramphenicol: 35mg/ml stock solution (add 1ml/L medium)
Tetracycline: 5mg/ml stock solution (add 3ml/L medium)

Opmerkingen




Oplossingen in ethanol of 50% ethanol bevriezen niet bij –20
graden, wat handig is voor opslag en gebruik
Antibiotica mogen niet toegevoegd worden aan heet medium, koel
het medium tot 55°C vooraleer antibiotica toe te voegen
Tetracycline is lichtgevoelig, platen en medium uit het licht bewaren
Meten van promotoractiviteit




Testpromotor, GFP-reporter, backbone plasmide
isoleren
Ligeren en cellen transformeren
Selectie m.b.v. antibioticumresistentie
Activiteit promotor vergelijken met standaardpromotor
(BBa_J23101).


Uitgedrukt in Standard Promoter Units (SPUs) zo dat je “part”
vergelijkbaar is met andere in de registry.
Je kan eigen metingen laten omzetten naar SPUs door
de online registry calculator te gebruiken
Meten van promotoractiviteit
Promotor- en ribosoomactiviteit in relatieve eenheden van Standard Promoting
Units (SPU) of Standard Ribosome Units (SRU)
Karakterisatie

Metingen van het populatiegemiddelde

Wanneer is het meten van het gedrag van de populatie of het
gemiddelde voldoende?




DNA


Plasmide copy nummer
RNA



Als we enkel geïnteresseerd zijn in het gedrag van de meerderheid van de
cellen.
1 enkele populatie
Tijdsafhankelijk gedrag kan weergegeven worden (via the plate reader)
Northern-bloths
RT-PCR
Proteins


Quantitative westernblots
Plate reader
Karakterisatie

Population distributions

Wanneer ben je geïnteresseerd in de populatiedistributies van
een groot aantal cellen?
Als er meerder populaties zijn
 Wanneer je duizenden cellen wil onderzoeken i.p.v. 10 of 100den
 Wanneer je enkel statisch gedrag nodig hebt
 DNA
 Mogelijkheid tot DNAkleuring met DAPI of iets anders om de
DNAinhoud in levende E. coli cellen te karakteriseren? Plasmide
copy number?
 RNA
 Versmelt reporters van single cel metingen met flowcytometrie
 Ontwikkel een hight troughput microscopieversie van één van de
single cell technieken hieronder


Proteins

Flow Cytometry gebruikmakende van fluorescent proteïne
Karakterisatie

Single cell metingen

Wanneer willen we het gedrag weten in een enkele cel?




Wanneer stochastische effecten belang hebben
Single molecule resolutie
Dynamisch gedrag(want time resolved behavior of each cell
lineage)
DNA


Hoe meet je plasmide kopie nummer in een enkele cel?
Misschien FCS gebruiken met een DNA-bindend proteïne specifiek
voor je plasmide geconjugeerd met GFP. Vereist veel werk omtrent
de methode
Karakterisatie

Single cell measurements

RNA
Endy: Journal Club: Le et al 2005
 Ido Golding approach
 Beide benaderingen zijn gebaseerd op hetzelfde soort RNA-MS2
proteïne binding. Le et al. Gebruikt dan FCS om niveaus van
gebonden proteïne aan RNA te meten terwijl Golding et al.
Individueel RNA tracht te traceren via fluorescentie microscopie.
Beide methodes zijn zeer gevoelig maar beiden verstoren
waarschijnlijk het systeem dat gemeten wordt.
 Protein
 Fluorescence correlation spectroscopy

Voorbeeld Part:BBa_F2620

Signaling part (want F)

Beschrijving:

Een transcriptiefactor [LuxR] (BBa_C0062) die actief is in
aanwezigheid van cel-cel signaalmolecule 3OC6HSL
gecontrolleerd door tetR reguleerbare operator (BBa_R0040).
Device input is 3OC6HSL. Device output is PoPS van een LuxRgereguleerde operator.
Voorbeeld: legende

BBa_C0062: luxR repressor/activator


3OC6HSL


Afkomstig van V. fischeri, bindt met het LuxRgenproduct van het Lux operon. Het
resulterende complex kan binden met de lux box en regelt transcriptie van de luxpromotors.
Part:BBa_R0040


Als gecomplexeerd met HSL, bindt LuxR aan de Luxpromotor en activeert de transcriptie van
Pr BBa_R0062,
Sequenties voor pTet inverting regulator. De promotor staat constitiutief aan en wordt
gerepressed door Tet R. TetR repressie wordt geïnhibeerd door toevoeging van tetracycline
en of zijn analoog aTc.
Polymerase Per Second:
Polymerase Per Second (PoPS) ; aantal keren dat een RNA polymerase molecule
een specifieke locatie (bvb. Promotor, RBS) op het DNA passeert per tijdseenheid.
PoPS wordt indirect gemeten door een test gen te introduceren met dezelfde
regulatorische regio, maar met een CFP proteïne coderend gen. De fluorescentie
wordt hiervan gemeten.
Voorbeeld: transferfunctie

De transferfunctie beschrijft het evenwicht tussen input (exogene HSL
concentratie) en output (PoPS) signaal. Een fluorescent reporter device
werd hiervoor gebruikt om de output te meten bij verschillende exogene
concentraties HSL.
Voorbeeld transferfunctie (2)
Voorbeeld: specificiteit

Specificiteit: onderscheid moet gemaakt kunnen worden tussen de echte
input en andere gelijkende inputs (veel AHL molecules met een gelijkende
structuur aan 3OC6HSL ). Karakterisatie van de respons van BBa_F2620
op andere AHL molecules is nodig.
Transferfuncties voor 8
verschillende AHL
molecules als input
Voorbeeld: responstijd


Responstijd meet de tijd voor de respons van de output op de input.
In dit voorbeeld: respons van BBa_F2620 gemeten d.m.v. stijging van het
inputsignaal (AHL concentratie van 0 tot 100 nM )stap voor stap
Voorbeeld: stabiliteit



“Device” stabiliteit
beschrijft hoe de
transferfunctie van het
device verandert na
verschillende rondes van
celdeling en in cultuur
brengen.
reporter device,
BBa_E0240 to indirectly
measure the output from
BBa_F2620
Performantie van het
device werd gemeten
onder hoge en lage
inputcondities over 92
generaties.
Performantie
constant
Performantie daalt
snel na 74
generaties
Voorbeeld stabiliteit (2)

Oorzaak van dalende performantie na 74
generaties:
 Deletiemutant
mutant die in het begin al in een fractie
van de cellen aanwezig was (die na 74 generaties de
cultuur overheerst bij hoge input)
Voorbeeld Part:BBa_F2620

Compatibiliteit

Bacteriële stam:


Plasmiden


Device werkt niet op alle plasmiden
Devices


transcriptie hangt af van de gebruikte stam (juiste
sigmafactoren, RNApolymerases)
Mogelijke interferentie met andere devices
Cel signalisatie

Crosstalk tussen verschillende quorum sensing systemen
Let’s start building!