Soorten eiwit-eiwit interacties

advertisement
FACULTEIT WETENSCHAPPEN
SCRIPTIE VOORGELEGD TOT HET BEHALEN VAN DE GRAAD VAN LICENTIAAT /
MASTER IN DE BIOTECHNOLOGIE
Academiejaar 2005-2006
Ontwikkelen en toepassen van technologie om
eiwitcomplexen uit plantencellen te isoleren
en analyseren
Lopes dos Santos Santiago Guido
Promotor: Prof. Dr. Dirk Inzé
Co-promotor: Dr. Geert De Jaeger
Begeleider: Drs. Jelle Van Leene
VAKGROEP MOLECULAIRE GENETICA
VIB-departement Plant Systems Biology
De leden van de leescommissie:
Prof. Dr Anna Depicker
Dr. Geert De Jaeger
Dr. Alain Goossens
Figuur op voorpagina:
Overzicht van de TAP-methode met de klassieke CPBZZ-tag. Het linkerpaneel stelt de eerste
affiniteitsstap voor en in het rechterpaneel ziet men de tweede affiniteitsstap.
Inhoudstafel
DEEL 1: LITERATUURSTUDIE
1
1.1. Experimentele detectie van eiwit-eiwit interacties
1.1.1. Inleiding
1
1
1.1.2. Detectie op basis van affiniteit
1.1.2.1. Eiwit affiniteitschromatografie
1.1.2.2. Co-immunoprecipitatie
1.1.2.2.1. Voordelen
1.1.2.2.2. Nadelen
1.1.2.3. Affiniteit-Tags (Constans, 2002)
1.1.2.3.1. Epitoop tagging
1.1.2.3.2. Eiwit-tags
1.1.2.3.3. Andere affiniteits-tags
1.1.2.4. Tandem Affinity Purification (TAP)
1.1.2.4.1. Inleiding
1.1.2.4.2. Overzicht van de TAP-methode (Puig et al., 2001)
1.1.2.4.3. Diversiteit en variaties van TAP-tag cassettes
1.1.2.4.3.1. N-terminale Tag (Puig et al., 2001)
1.1.2.4.3.2. De “Split Tag” (Puig et al., 2001)
1.1.2.4.3.3. De Subtractie methode (Puig et al., 2001)
1.1.2.4.3.4. Localization and Affinity Purification (LAP) (Cheeseman et al., 2005)
1.1.2.4.4. Merking van het doelwit proteinemet de TAP-tag (Puig et al., 2001)
1.1.2.4.5. Voordelen en nadelen
1.1.2.5. Multidimensional Protein Identification Technology (MudPIT)
1.1.3. Blue-Native PAGE
1.1.4. Yeast 2 Hybrid
1.1.4.1. Voordelen en nadelen
1.1.5. FRET (Fluorescence/Förster detected Resonance Energy Transfer)
1.1.6. Proteïne-microarray analyse
1.1.7. Proteïne display
1.1.7.1. Faag display
1.1.7.2. Cel gebaseerde display (Li, 2000)
1.1.7.3. Peptide-on-DNA/RNA display (Li, 2000)
1
1
2
3
3
3
3
4
4
5
5
5
8
9
10
10
11
12
13
14
15
16
17
18
20
21
22
23
23
1.2. In silico predictie van eiwit-eiwit interacties
1.2.1. Ontwikkelen van eiwit-eiwit interactie databases
1.2.2. Computationele methoden
25
25
25
1.3. RNA-geïnduceerd Gene Silencing (Waterhouse et al., 2002)
1.3.1. Inleiding
1.3.2. Microprojectiel bombardement en agro-infiltratie
1.3.3. Virus geïnduceerde co-suppressie (VIGS)
1.3.4. Amplicon en hairpin RNA transgenen
1.3.5. Transcriptionele co-suppressie
1.3.6. Toepassing van RNAi in TAP, de iTAP-strategie (Forler et al., 2003)
1.3.7. Vectoren voor RNAi
27
27
28
29
29
30
30
31
1.4. Optimalisatie van transgenexpressie via toevoegen van introns
1.4.1. Studies in planten
32
34
DEEL 2: DOELSTELLING
36
DEEL 3: MATERIAAL EN METHODEN
38
3.1. Gebruikte stammen en cellen
3.1.1. Bacteriële stammen
38
38
Inhoudstafel
3.1.2. Plantencellen
38
3.2. Groeimedia
38
3.3. Vectoren
3.3.1. pDONRTM221 (Invitrogen)
3.3.2. pDonrP4P3
3.3.3. pAGRIKOLA
41
41
42
42
3.4. Recombinante DNA-technieken
3.4.1.BAC-isolatie
3.4.2. Fenolextractie
3.4.3. Plasmidebereidingen
3.4.3.1. Nucleobond DNA zuivering (midi)
3.4.3.2. Promega DNA zuivering op kleine schaal (mini)
3.4.3.3. Roche DNA-zuivering op kleine schaal (mini)
3.4.4. PCR
3.4.5. Restrictiedigesten
3.4.6. Ligatie
3.4.7. Gateway™ Klonering
3.4.7.1. De BP- recombinatie reactie
3.4.7.2. De LR-recombinatie reactie
3.4.8. Agarose Gelelektroforese
43
43
45
46
46
48
50
52
55
57
58
58
60
62
3.5. Transformatie
3.5.1. Transformatie van competente E. coli cellen
3.5.2. Transformatie van competente Agrobacterium tumefacians cellen
3.5.3. Transformatie van PSB-d Arabidopsis thaliana cellen
64
64
66
66
3.6. Eiwittechnieken
3.6.1. Eiwitextractie bereiding voor expressie-analyse
3.6.1.1 Proteïne-concentratiebepaling van proteïne-extracten (bereid met HB-buffer) van Arabidopsis
celsuspensies volgens de methode van Bradford.
3.6.2. SDS-PAGE
3.6.2.1. De polyacrylamide gel
3.6.2.2. Behandelen van het staal
3.6.3. Western Blot
3.6.4. Immunodetectie
3.6.4.1. Enhanced Chemiluminescence (ECL) detectie
3.6.4.2. Alkalisch fosfatase detectie
3.6.5. TAP (CBPZZ) protocol
3.6.5.1. TAP- zuivering
69
69
DEEL 4. RESULTATEN EN DISCUSSIE
4.1. Optimalisatie van transgenexpressie door toevoeging van introns.
4.1.1. Kloneringsstrategie
4.1.1.1. Oppikken van genen via PCR
4.1.1.2. Constructie van Entry-vectoren
4.1.1.3. Constructie van TAP-expressievectoren met introns
4.1.2. Transformatie naar PSB-d celsuspensie cultuur
4.1.2.1. Transformatie naar Agrobacterium tumefaciens
4.1.2.2. Transformatie naar PSB-d
4.1.3. Expressie analyse
4.2. Silencing d.m.v. RNAi
4.2.1. Kloneringsstrategie
4.2.1.1. Adaptor-PCR
4.2.1.2. BP-recombinatie reactie
70
71
71
74
76
77
78
79
81
83
86
86
86
86
89
94
96
96
96
98
102
102
102
103
Inhoudstafel
4.2.1.3. LR-recombinatie reactie
4.2.2. Supertransformatie naar transgene CDKA;1-TAP lijnen
4.2.2.1. Transformatie naar Agrobacterium tumefaciens
4.2.2.2. Supertransformatie
4.2.3. Expressie analyse
4.3. C-terminale versus N-terminale tagging
4.3.1. Kloneringstrategie
4.3.1.1. Klonering van de 35S promotor in pDonrP4P3
4.3.1.2. De LR- recombinatie reactie voor N-TAP fusies
4.3.2. Transformatie naar PSB-d plantencellen
4.3.3. Expressie analyse
4.3.4. Tandem Affinity Purification
104
106
106
106
107
110
110
110
112
113
114
117
DEEL 5: SAMENVATTING
119
REFERENTIES:
122
Woord vooraf
Ik zou graag Prof Dr. Dirk Inzé willen bedanken voor de aangeboden kans om te mogen
werken en leren in het PSB departement van het VIB.
Dr. Geert De Jaeger wil ik bedanken voor de mogelijkheid die ik heb gekregen om te werken
in de ‘Functional Proteomics’ groep, voor zijn begeleiding en zijn aangename lessen in de
eerste licentie Biotechnologie.
Jelle Van Leene wil ik bedanken voor zijn uitstekende begeleiding, geduld en de kennis die ik
heb gekregen over het praktische werk in een labo. Je had het nooit te druk om me te helpen
en daar ben ik je zeer dankbaar voor.
Gert Van Isterdael wil ik bedanken voor wat hij mij geleerd heeft en wens hem veel succes
met wat hij zal leren als jonge vader.
Eveline Van De Slijke bedank ik voor de hulp op mijn hulpeloze momenten.
Geert Persiau, bedankt voor het verklappen van je TAP-geheimen.
Jan Geerinck wil ik bedanken voor de hulp (met mijn titelblad onder andere) en de
geanimeerde gesprekken.
Het voltallige Functional Proteomics groep bedank ik voor het warme welkom, jullie waren
een toffe groep om mee samen te werken.
Ik wil mijn ouders, Orlando en Idalina bedanken voor wat ze mij geleerd hebben, mijn
moeder voor haar geduld, steun doorheen al deze jaren (Querer é Poder!!!).
Dank aan:
Mijn broer Artinizio en zus Artinizia voor hun steun.
Mijn familie in Rotterdam, mijn grootouders Ricardo Francisco Lopes, Maria Adelaide Lopes
en Manuel Santos Junior.
Mijn broeders Said en Steffen, Inge en Vicky (voor je steun gedurende al deze jaren en de
komende jaren…).
Mijn collega’s en vrienden Kevin, Rania, Kim Nijs, Kim, Kirsten, Valerie, Emilie, Renske…
De levenslessen getrokken in mijn Stad (Deurne, Linkeroever, Borgerhout), mijn vrienden
van weleer: Rachid, Fohad, Mohamed Boulafati, Mohamed Achrak (R.I.P 26/11/02),...
Mijn ex-collega’s in Opel Belgium, vooral Mohamed Akkouh en Ibrahim Akkouh.
Ik dank de mensen die mij gesteund hebben en diegene die dat niet hebben gedaan.
Dank aan Felino Alve Jesus en Antonio Cottas.
Falen doet zeer, maar opgeven nog meer.
Lopes dos Santos Santiago Guido
Deel 1: Literatuurstudie
Deel 1: Literatuurstudie
1.1. Experimentele detectie van eiwit-eiwit interacties
1.1.1. Inleiding
Met het vervolledigen van genoomsequeneringen voor 60 prokaryote organismen en
verschillende belangrijke eukaryotische organismen, inclusief het menselijk genoom, is de
volgende grote uitdaging het ontcijferen van de relaties tussen de individuele genen en het
begrijpen van de moleculaire organisatie van cellulaire netwerken. Dit vereist informatie
over de stabiele proteïnecomplexen, die de functionele eenheden zijn van de cellulaire
moleculaire machinerie en de studie van kortstondige eiwit-eiwit interacties (Shevchenko
et al., 2002).
Twee sterke benaderingen zijn populair geworden in het bestuderen van eiwit-eiwit
interacties. De eerste is de zuivering van proteïnecomplexen via affiniteitschromatografie
gekoppeld aan de identificatie van de componenten via massaspectrometrie (MS) en de
tweede is het Yeast 2 Hybrid (Y2H) systeem.
De veelzijdigheid en gevoeligheid van de two-hybrid en MS-gebaseerde benaderingen
hebben geleid tot het gebruik van deze technieken in het groeiende veld van proteomics.
Dit gebruik wordt het beste geïllustreerd met het ambitieus project om het gist
interactoom te karteren (Gavin et al., 2006).
Two-hybrid en MS-gekoppelde technieken bestuderen verschillende aspecten van eiwiteiwit interacties (binaire interacties en proteïne complexvorming respectievelijk), daarom
zal enkel door combinatie van de data bekomen uit complementaire technologieën zoals
Y2H-en MS-gebaseerde benaderingen het interactoom in zijn volledigheid ontrafeld
worden (Causier et al., 2004).
1.1.2. Detectie op basis van affiniteit
1.1.2.1. Eiwit affiniteitsschromatografie
Bij affiniteitsschromatografie wordt een celextract over een kolom gestuurd waarop een
ligand geïmmobiliseerd is dat specifiek met het doelwitproteïne zal reageren. Het
doelwitproteïne bindt op de kolom en de ongewenste eiwitten worden weggewassen. De
1
Deel 1: Literatuurstudie
doelwitproteïnen reageren met verschillende substanties: enzymen met substraten,
receptoren met liganden, antigenen met antilichamen, enz. Elutie kan op verschillende
manieren gebeuren: er wordt een onderscheid gemaakt tussen harde elutie, b.v.b. met
hoog zout, extreme pH, ... en zachte elutie, b.v.b. elutie met een protease.
Affiniteitsschromatografie is zeer gevoelig maar valse positieven wegens non-specifieke
bindingen zijn wel mogelijk.
Bij immuno-affiniteitsschromatografie is het ligand een mono- of polyklonaal antilichaam
dat het eiwit van interesse specifiek herkent. Het antilichaam wordt covalent gekoppeld
aan een dragermatrix bvb. agarose of sepharose. Op deze kolom wordt dan het
eiwitextract geladen dat het eiwit van interesse bevat. Het voordeel van immunoaffiniteitsschromatografie is dus dat er geen transformaties nodig zijn. Een nadeel is dat er
voor elk eiwit van interesse wel een specifiek antilichaam vereist is, dat dikwijls niet
voorhanden is. Deze methode kan dus niet gebruikt worden om op grote schaal
eiwitinteracties te gaan bestuderen (Constans, et al. 2002).
1.1.2.2. Co-immunoprecipitatie
Co-immunoprecipitatie is een klassieke methode om proteïne-proteïne interacties te
detecteren en werd al in letterlijk duizenden experimenten gebruikt. Het basisexperiment
is eenvoudig. Cellysaten worden bereid, antilichaam wordt toegevoegd, het antigen word
neergeslaan en gewassen en gebonden proteïnen worden geëlueerd en geanalyseerd.
Het antigen gebruikt om de antilichamen te maken kan een gezuiverd proteïne (ofwel van
natuurlijk weefsel of organisme of gezuiverd na expressie in een ander organisme) of
synthetisch peptide gekoppeld aan een drager zijn; het antilichaam kan poly -of
monoklonaal zijn. Een andere mogelijkheid is dat het proteïne een epitoop-tag kan dragen
waarvoor commerciële antilichamen beschikbaar zijn (HA - en c-Myc-tags zijn algemeen
gebruikte tags) of een proteïne-tag (zoals GST) waarvoor parels beschikbaar zijn voor
snelle zuivering van de fusieproteïnen en co-zuiverende proteïnen.
2
Deel 1: Literatuurstudie
1.1.2.2.1. Voordelen
 Het antigen en de interagerende proteïnen zijn aanwezig in dezelfde relatieve
concentraties als gevonden in de cel, dus artificiële effecten door opzettelijke
overproductie van de testproteïne worden vermeden
 De proteïnen zijn aanwezig in hun natuurlijke staat van posttranslationele
modificatie (v.b. fosforylatie).
1.1.2.2.2. Nadelen
 Co-immunoprecipiterende proteïnen interageren niet noodzakelijk rechtstreeks met
elkaar, aangezien ze deel kunnen uitmaken van grotere complexen.
 Co-precipitatie is niet zo gevoelig als andere technieken, zoals proteïneaffiniteitsschromatografie, omdat de hoeveelheid geprecipiteerd doelwitproteïne
lager
is
dan
de
hoeveelheid
gezuiverd
doelwitproteïne
in
affiniteitsschromatografie.
1.1.2.3. Affiniteit-Tags (Constans, 2002)
1.1.2.3.1. Epitoop tagging
Deze methode is algemeen toepasbaar en geeft de mogelijkheid om laag abundante
eiwitten en eiwitcomplexen te zuiveren.
Ectopische genexpressie is noodzakelijk en de tag kan de functie van het eiwit
beïnvloeden.
Gevoeligheid is belangrijk bij epitoop tagging, daarom gebruikt men meestal
tandemkopies van de tag, wat kan leiden tot een betere zuivering en dus een hogere
gevoeligheid.
Voorbeelden van epitoop-tags zijn:
 HA-tag : Hemaglutinine tag bindt anti-HA antilichaam.
 FLAG

systeem voor zuivering van fusieproteïnen met de FLAG sequentie
(N-AspTyrLysAspAspAspAsp-Lys-C).
Wordt
primair
gebruikt
voor
3
Deel 1: Literatuurstudie
proteïnedetectie maar kan ook gebruikt worden voor affiniteitszuivering. Deze
tag bindt een anti-FLAG antilichaam.
 c-Myc: deze tag bindt anti-Myc antilichaam.
1.1.2.3.2. Eiwit-tags
Normaal worden ze gebruikt als een manier om eiwitten of eiwitcomplexen te zuiveren in
standaard condities, daarnaast worden ze gebruikt als hulpmiddel om het fusieproteïne
meer oplosbaar te maken (voorbeelden zijn maltose binding protein (MBP), glutathione Stransferase (GST) en thioredoxine) of eiwitten te localiseren (bijvoorbeeld green
fluorescent protein of GFP).
Een nadeel is wel dat de tags zeer groot zijn. Voorbeelden zijn:
 GST-tag: één van de meest voorkomende en oudste affiniteitszuivering methodes
gebruikt glutathione als ligand
 MBP-tag: heeft affiniteit voor amylose
 Proteïne A tag (zie 1.1.2.4.)
1.1.2.3.3. Andere affiniteits-tags
 Oligohistidine tags: worden gebruikt bij IMAC (Immobilized Metal Ion Affinity
Chromatography). De affiniteit van histidine imidazool zijketens voor metaal
ionen als nikkel, zink en kobalt wordt hier toegepast.
 Strep-Tag: deze fusie methode steunt op de bindingsaffiniteit van biotine voor
streptavidine of avidine. De strep-tag is een kort peptide dat de chemische
eigenschappen van biotine nabootst en bijgevolg ook bindt aan (strept)avidine.
Elutie gebeurt door competitie met biotine of het biotine-analoog desthiobiotine.
 CBP-tag: deze tag is gebaseerd op de affiniteit van calmoduline voor het
calmoduline bindend peptide (CBP). De interactie is afhankelijk van de
aanwezigheid van calcium ionen en van dit principe wordt gebruik gemaakt tijdens
de elutie. Chelatie of wegnemen van de calcium ionen met EDTA of EGTA leidt
tot disruptie van de binding.
4
Deel 1: Literatuurstudie
1.1.2.4. Tandem Affinity Purification (TAP)
1.1.2.4.1. Inleiding
De tandem affiniteitszuivering (TAP) is een algemene procedure om proteïnen te zuiveren
onder natuurlijke omstandigheden. Via de TAP-tag krijgen we snelle zuivering van
proteïnecomplexen uit cellen, zonder op voorhand de compositie, activiteit of functie van
het te onderzoeken complex te kennen.
TAP in combinatie met massaspectrometrie laat ons toe de proteïnen te identificeren die
met het doelwitproteïne interageren en meegezuiverd werden (Rigaut et al., 1999).
Sinds Rigaut et al. (1999) de TAP methode en diens toepassing in de zuivering van
eiwitcomplexen uit gist beschreven, zijn in de jaren daarna verschillende studies geweest
die de toepassing van TAP in verscheidene andere organismen beschrijven. TAPgezuiverde complexen zijn al geïsoleerd geweest uit bacteriën, gist, zoogdiercellen,
insectencellen, tabak, rijst en Arabidopsis. Het TAP-systeem werd al toegepast in
proteïnecomplex isolatie uit planten in een transiënt expressie systeem en recentelijk heeft
men ook stabiel getransformeerde transgene lijnen kunnen maken met geTAP-tagged
proteïne. Zulke benadering laat de moleculaire en functionele karakterisatie van de TAPfusie in context van de hele plant toe, evenals de zuivering van proteïnen onder
fysiologische condities. De effecten op eiwitcomplex samenstelling, modificaties en
activiteit te wijten aan een wijder arsenaal aan groeicondities, stimuli en plantmateriaal
gebruikt gedurende de zuivering kunnen geschat worden (Rubio et al., 2005).
1.1.2.4.2. Overzicht van de TAP-methode (Puig et al., 2001)
Fig. 1.1: Voorbeeld van een TAP-tag gefusioneerd aan een bait X (verschillende variaties zijn mogelijk).
Figuur overgenomen uit: http://content.febsjournal.org/content/vol270/issue4/cover.shtml
5
Deel 1: Literatuurstudie
De TAP-methode omvat de fusie van de TAP-tag aan de doelwitproteïne (X op de figuur
1.1 , ook wel “bait” genoemd) en het binnenbrengen van dit construct in de gastcel of het
gastorganisme, zodanig dat het natuurlijke niveau van expressie van het fusieproteïne
(doelwitproteïne + tag) behouden wordt. In gist is homologe recombinatie mogelijk en
wordt het endogene eiwit volledig vervangen door het geTAP-tagged eiwit, in planten is
dit niet zo. Overexpressie van de proteïne kan vaak leiden tot vorming van non-specifieke
en/of niet-natuurlijke proteïne-interacties met de gastcel proteïnen.
In het kader van deze thesis werd gebruik gemaakt van PSB-d cel suspensie culturen
afgeleid van Arabidopsis thaliana, ecotype Landsberg erecta. Deze cellen hebben een 8C–
DNA inhoud (C staat voor de DNA inhoud van het ongerepliceerde haploïde chromosoom
complement), d.w.z. dat elke gen in meerdere kopijen (8) voorkomt en de competitie met
het endogene eiwit dus zeer groot is, wat overexpressie dikwijls noodzakelijk maakt.
De TAP-tag bestaat uit het calmoduline binding peptide (CBP) en twee IgG(Immunoglobuline G) bindende domeinen van het Staphylococcus aureus proteïne A,
gescheiden door een TEV (Tobacco Etch Virus)-protease klievingsplaats (Figuur 1.1). De
TAP-tag (ongeveerd 20 kDa groot) kan C- of N-terminaal aan de doelwitproteïne
gefusioneerd worden.
De fusieproteïne en geassocieerde componenten worden uit het celextract gerecupereerd
door affiniteits-selectie op een sepharose-matrix waarop covalent humane IgG’s gebonden
zijn (Figuur 1.2). De proteïne A-tag zal binden met de IgG-matrix. Deze binding is zeer
sterk, waardoor we normaal enkel kunnen elueren onder harde condities (vb. lage pH,
chaotrope agentia, ...) waarbij complexen uiteenvallen, maar dankzij de TEVklievingplaats is zachte elutie met het zeer specifieke TEV-protease mogelijk.
Na het wegwassen van contaminanten met buffers die de fysiologische condities van de
cel nabootsen, voegt men TEV-protease toe om het gebonden materiaal vrij te stellen.
TEV-protease knipt de TAP-tag zeer specifiek ter hoogte van de 6 aminozuren lange
TEV-klievingssite. Het TEV-protease wordt best in de eerste affiniteitsstap gebruikt om
ophoping van TEV-protease na de tweede affiniteitsstap te vermijden, waardoor het
zuiveren van het complex moeilijk zou worden, wegens de veelvuldige contaminatie met
TEV-protease .
Het eluens wordt in aanwezigheid van calcium ionen geïncubeerd met agarose parels die
een calmodulinemantel bevatten, deze zullen binden met het Calmoduline Bindend
Peptide (de CBP-tag ) op de resterende TAP-tag cassette. Deze tweede affiniteitsstap is
nodig om zowel het TEV-protease als sporen van achtergebleven contaminanten uit de
6
Deel 1: Literatuurstudie
eerste affiniteitsstap te verwijderen. Na het wassen wordt het gebonden materiaal
vrijgesteld met EGTA (dit is een molecule die calcium uit de oplossing cheleert en zo de
interactie CBP-calmoduline verbreekt) en kan het geanalyseerd worden (Rigaut et al.,
1999).
Het gewonnen materiaal kan op verschillende manieren geanalyseerd worden (Figuur 1.3)
en activiteitstesten op gezuiverde complexen zijn mogelijk (vb. kinase assays). Voor
proteïnecomplex karakterisering worden de proteïnen geconcentreerd en tenslotte
gefractioneerd op een denaturerende gel gevolgd door identificatie met behulp van MS.
Als alternatief voor identificatie van de componenten kunnen Edman-degradatie of
Western Blotting gevolgd door immunodetectie gebruikt worden (Puig et al.,2001). De
reproduceerbaarheid en de gevoeligheid kunnen verbeterd worden door het gebruik van 2
onafhankelijke methoden van staalbereiding en complementaire MS-procedures. Krogan
et al. (2006) gebruikten voor hun onderzoek in gist “matrix-assisted laser
desorption/ionization – time of flight” (MALDI-TOF) en data-afhankelijke “liquid
chromatography tandem mass spectrometry “ (LC-MS/MS). Dit is vooral interessant bij
proteïnen met lage abundantie en daarnaast leverde LC-MS/MS bijkomende identificaties.
Fig. 1.2: Overzicht van de TAP-methode met de klassieke CPBZZ-tag. Het linkerpaneel stelt de eerste affiniteitsstap
voor en in het rechterpaneel ziet men de tweede affiniteitsstap.
Figuur overgenomen uit: http://content.febsjournal.org/content/vol270/issue4/cover.shtml
7
Deel 1: Literatuurstudie
Fig. 1.3: Proteïne identificatie d.m.v tandem MS. Een eiwitcomplex wordt gescheiden m.b.v 1D-PAGE en de bandjes van interesse worden
uit de gel gesneden, vervolgens aan een digestie met trypsine onderworpen. De bekomen peptiden worden via MS partieel gesequeneerd.
Het proteïne wordt via eiwitsequentie databanken geïdentificeerd (Droit et al., 2005).
1.1.2.4.3. Diversiteit en variaties van TAP-tag cassettes
TAP van proteïnecomplexen gebruikt 2 sequentiële affiniteits-tags om contaminatie van
eiwitten die op niet-specifieke wijze interageren met het gemerkte proteïne of de
chromatografische matrices te verminderen. Alternatieve TAP-tags met andere affiniteitstags en protease klievingsplaatsen werden ontwikkeld. De originele CBP-TEV-ZZ TAPtag is duidelijk effectief, er zijn al vele proteïnecomplexen mee geïsoleerd, maar er zijn
wijzigingen in het originele TAP-tag gemaakt om potentiële problemen met diens
onderdelen te voorkomen.
Eén van deze problemen is de grootte van de tag, deze zou de werking van de tag kunnen
verminderen of de complexvorming met andere eiwitten verhinderen. Er zijn vele
interactie- en immuno-affiniteits-tags (grootorde van 5 tot 51 aminozuren) die gebruikt
kunnen worden i.p.v CBP en ProtA (Brown et al., 2006).
Voorbeelden van kleinere TAP-constructen zijn de “sequential peptide affinity”(SPA)tags, gemaakt door substitutie van het ProtA domein (137 aminozuren) met de 3x FLAG-
8
Deel 1: Literatuurstudie
epitoop (22 aminozuren) (Zeghouf et al., 2004) of vervanging van CBP met een spacer en
een enkele FLAG-sequentie (Kneusel et al., 2003).
Rubio et al. (2005) construeerden een alternatief TAP-systeem, namelijk de TAPa-tag die
gelinkt werd aan een subunit van het COP9-signalosoom. De TEV-protease
klievingsplaats werd vervangen door de meer specifieke (8 aminozuren) en bij lage
temperatuur actieve rhinovirus 3C-protease site. Hierbij kan de tweede purificatiestap
uitgevoerd worden via twee verschillende affiniteits-tags, namelijk een zes histidine
(6xhis) repeat of negen kopijen van de c-myc tag (9xmyc). In tegenstelling tot de originele
TAP-strategie, kunnen alle stappen bij TAPa-zuivering efficiënt uitgevoerd worden bij
4°C i.p.v bij 16°C tijdens TEV-elutie, wat meer stabiele complex isolatie zou moeten
toelaten. De laatste elutiestap vergt geen EDTA of EGTA, wat zou moeten helpen zowel
bij het behoud van de integriteit van bepaalde complexen als bij het behoud van activiteit
van kation-afhankelijke enzymen zoals metalloproteasen.
Nog een andere trifunctionele zuiverings-tag werd gemaakt, 65 aminozuren groot,
bestaande uit CBP, 6xHis en de 3x haemaglutinine (HA)-epitoop. Deze tag werd gebruikt
om interagerende proteïnen in S. cerevisiae te identificeren (Honey et al., 2001).
De noodzaak voor kleinere of veranderde TAP-tags voor het isoleren van specifieke
proteïnen in natieve complexen zal op empirische basis moeten bepaald worden. Het
testen van de functionaliteit van gemerkte proteïnen d.m.v. complementatie van knock-out
mutanten kan een indicatie geven van de kans op slagen van de TAP-tag, maar factoren
zoals het expressieniveau van de TAP-constructen, de hoeveelheid startmateriaal waaruit
complexen worden gezuiverd en het gebruik van N- of C-terminale merking van de “bait”
kunnen kritische factoren zijn in het succes van TAP-experimenten (Brown et al., 2006).
1.1.2.4.3.1. N-terminale Tag (Puig et al., 2001)
Fig. 1.4: Schematische voorstelling van de C-en N- terminale TAP-tags. Eventueel kan het NTAP-construct Cterminaal enterokinase bevatten, maar dit is geen vereiste voor de correcte werking van NTAP-fusies (Puig et al., 2001)
9
Deel 1: Literatuurstudie
Soms zal de toevoeging van een C- terminale tag aan een gisteiwit via homologe
recombinatie diens functie verhinderen en leiden tot een groeidefect of zelfs celdood van
de haploïde cel wanneer het eiwit essentieel is en het niveau van activiteit dat behouden
werd onvoldoende is om het leefbaar te houden. Dit gebeurt niet frequent, slechts in 5%
van de door Puig et al. (2001) geteste proteïnen. Een simpel alternatief is het toevoegen
van de tag aan de amino-terminus van het doelwitproteïne. De N-terminale TAP-tag bevat
dezelfde modules als de C-terminale TAP-tag, maar in omgekeerde volgorde (Figuur 1.4).
Aangezien de Proteïne A module tijdens de eerste affiniteitsstap moet afgekliefd worden,
moet het zich bevinden aan de extreme terminus van het proteïne. Er werd ook een
enterokinase (EK) klievingsplaats geïntroduceerd stroomafwaarts van het CBP, zodat
volledige verwijdering van tag residu’s van het gemerkte eiwit mogelijk is.
1.1.2.4.3.2. De “Split Tag” (Puig et al., 2001)
Een tweede variatie van de originele TAP-methode bestaat uit de toevoeging van de 2
functionele helften van de TAP-tag aan 2 verschillende proteïnen van hetzelfde complex.
Met andere woorden de Proteïne A en TEV-protease klievingsplaats worden gefusioneerd
aan 1 proteïne terwijl CBP gefusioneerd wordt aan een tweede doelwitproteïne. Deze
techniek laat de zuivering toe van eiwitcomplexen die 2 gegeven proteïnen bevatten, zelfs
wanneer er maar een kleine fractie van de doelwitproteïnen geassocieerd is, m.a.w.
wanneer grote fracties vrij of gebonden blijven aan andere complexen.
1.1.2.4.3.3. De Subtractie methode (Puig et al., 2001)
Deze strategie is nuttig wanneer 2 of meer complexen een gemeenschappelijke subunit
delen, maar enkel 1 van deze complexen ons interesseert. Een proteïne specifiek voor het
ongewenste complex wordt gefusioneerd aan ProteïneA (zonder de TEV-klievingsplaats).
Terwijl beide complexen worden weerhouden op de eerste IgG-affiniteitsskolom, kan het
ongewenste complex niet geëlueerd worden aangezien de ProtA-gemerkte specifieke
subunit vastgehecht blijft aan de matrix. Alleen het doelwitcomplex wordt geëlueerd en
gezuiverd tijdens de tweede stap.
10
Deel 1: Literatuurstudie
1.1.2.4.3.4. Localization and Affinity Purification (LAP) (Cheeseman et al., 2005)
Naast de originele TAP-tag (CBP,TEV, Proteïne A), zijn er nog talrijke andere variaties
gebaseerd op andere purificatie-tags mogelijk, inclusief 6xHis (bindt met nikkel), Speptide (bindt aan S proteïne), haemaglutinine (HA)-peptide (herkend door antilichamen
tegen HA) en c-myc peptide (herkend door antilichamen tegen c-myc) evenals andere sitespecifieke proteases waaronder Amersham’s PreScission protease 3C (i.p.v. TEV).
TAP-tag procedures zijn voornamelijk in gist gebruikt, waar homologe recombinatie
efficiënte integratie van de tag aan de C-terminus van de genomische locus in een
haploïde stam toelaat. Hoewel er methoden bestaan om vele andere eukaryoten te
transformeren, verhindert de lagere efficiëntie van homologe recombinatie (in vergelijking
met gist) de high-throughput moleculaire vervangingen om op een effectieve wijze de
TAP-tag strategie te gebruiken.
Om procedures te ontwikkelen die de analyse van proteïnecomplexen vergemakkelijken in
metazoa, inclusief in Caenorhabditis elegans en humane cellen, ontwierpen Cheeseman et
al. (2005) een gemodificeerde versie van de TAP-tag, die met behulp van het ‘Green
Fluorescent Protein’ (GFP) kan gebruikt worden om proteïnen te lokaliseren in levende
cellen. In deze zuiveringsmethode wordt GFP ook gebruikt als eerste purificatie-tag (i.p.v
het ZZ-domein van proteïne A in de originele TAP-tag). Omdat dit type van genetische
tag kan gebruikt worden voor lokalisatie en affiniteitszuivering, noemen Cheeseman et al.,
(2005) deze techniek “Localization and affinity purification” (LAP)-tag (Figuur 1.5).
Het gebruik van GFP als de primaire purificatie-tag heeft twee bijkomstige voordelen.
Ten eerste, getransformeerde cellen of stammen kunnen geïdentificeerd worden door het
screenen naar fluorescentie en cellen of stammen die een voldoende hoeveelheid van het
fusieproteïne expresseren kunnen geselecteerd worden ofwel door gebruik van een
fluorescentiemicroscoop of met behulp van flowcytometrie. Ten tweede de lokalisatie
dynamica van het geëxpresseerde fusieproteïne kan dienen als een partiële indicator van
diens functionaliteit. Bijvoorbeeld, wanneer het endogene proteïne zich bevindt ter hoogte
van de mitotische chromosomen, dan zou de geëxpresseerde LAP-fusie zich ook moeten
bevinden ter hoogte van de mitotische chromosomen. Hoewel dit niet het equivalent is
van “genetic rescue” in haploïde gistcellen, geeft het enige indicatie of het exogeen
geëxpresseerde proteïne de functie behoudt van het endogene proteïne.
11
Deel 1: Literatuurstudie
Fig. 1.5: N-en C- terminale LAP tag: een overzicht van de LAP zuiveringsmethode. Bij het gebruik van de S-proteine
elueert men met ureum, gebruikt men 6xHis als tag, dan gebeurt de elutie met EDTA
Fig. overgenomen uit (Cheeseman et al., 2005)
De LAP-strategie zou moeten werken in elk organisme waarin het mogelijk is om een
stabiele transformant te maken. Deze strategie werd reeds succesvol gebruikt in C.
elegans en humane cellen. Het zou mogelijk moeten zijn om deze techniek aan te passen
aan Escherichia coli, fungi, Arabidopsis, Drosophila en de meeste andere organismen.
1.1.2.4.4. Merking van het doelwit proteinemet de TAP-tag (Puig et al., 2001)
Gewoonlijk kunnen standaard DNA-kloneringprocedures (vb m.b.v restrictie-enzymen of
Gateway-kloneringen) gebruikt worden om N- of C-terminale TAP-tag fusies in de juiste
expressievector te maken, ‘in frame’ met de coderende regio van het eiwit van interesse.
De recombinante expressievector kan transiënt of stabiel in de cel of organisme worden
gebracht. In het meest optimale geval zou het gemerkte construct gebruikt moeten worden
om het endogene wild type (WT) gen te vervangen, maar dit is niet altijd mogelijk.
Wegens de hoge efficiëntie van homologe recombinatie in gist is er geen plasmide nodig
om de TAP-tag te fusioneren aan het eiwit van interesse. Polymerase kettingreactie (PCR)
fragmenten kunnen gebruikt worden om de TAP-tag direct in het genoom te kloneren. Cterminale TAP-tags worden preferentieel gebruikt, want op deze wijze wordt de expressie
van het doelwitproteïne onder de controle van diens natuurlijke promotor geplaatst.
12
Deel 1: Literatuurstudie
1.1.2.4.5. Voordelen en nadelen
De complete TAP-zuivering kan in minder dan een dag uitgevoerd worden. De
kloneringen, transformaties en het upscalen in plantencelculturen neemt ongeveer 3
maand in beslag. De totale kosten zijn laag, wat toepassingen op grote schaal toelaat.
De zuivering bestaat uit 2 zachte elutiestappen, ondanks de sterke binding, nodig voor een
hoge opbrengst, en gebeurt in buffers die fysiologische condities van de cel nabootsen. Dit
resulteert in het behoud van de integriteit van de complexen. De ganse TAP-procedure
gebeurt bij 4°C (behalve TEV-elutie bij 16°C) om eiwitafbraak te vermijden. Wanneer
zeer onstabiele eiwitten geTAP-tagged zijn, kan de TEV-elutie ook overnacht bij 4 oC
gebeuren.
Problemen kunnen ontstaan wanneer een subunit van het doelwitcomplex een TEVprotease klievingsplaats bevat, dit gebeurt zeer zelden gezien de hoge specificiteit van het
TEV-protease . EGTA kan de stabiliteit van het complex beïnvloeden en zo de functionele
karakterisering van de activiteit van het complex belemmeren, maar niet de subunit
identificatie.
De TAP-procedure is veelzijdig. Vergeleken met andere tags zoals, de c-myc of HA-tag,
geeft TAP hogere opbrengsten van affiniteit-gezuiverde proteïnen en een lagere
achtergrond van niet-specifiek geassocieerde proteïnen. (Shevchenko et al., 2002).
De TAP-procedure heeft gelijkaardige toepassingen als de Yeast 2 Hybrid methode, maar
een verschil is dat onder de gegeven omstandigheden, zowel direct als indirect
interagerende componenten in 1 enkel experiment kunnen geïdentificeerd worden.
Het TAP-systeem geeft ook een indicatie van de stoichiometrie van de proteïnen in een
gegeven complex en laat directe biochemische analyse toe van de gezuiverde proteïnen, in
het bijzonder de activiteit van mutante complexen kunnen gemakkelijk geanalyseerd
worden. TAP wordt niet enkel gebruikt om eiwit-eiwit interacties te identificeren, maar
daarnaast kunnen liganden die meegezuiverd worden ook gekarakteriseerd worden. De
relatieve gevoeligheid en foutmarges van de TAP-strategie en het Y2H systeem moeten
nog bepaald worden. Vermeldenswaardig is dat alle 10 U1 snRNP (small nucleolar
ribonucleoproteïnen) specifieke proteïnen geïdentificeerd werden met de TAP-methode,
terwijl geen enkel U1 snRNP-specifiek proteïne werd gevonden met Yeast 2 Hybrid,
waarbij 2 verschillende gist U1 snRNP-proteïnen werden gebruikt als “bait” (Rigaut et al.,
1999).
13
Deel 1: Literatuurstudie
Een eigenschap van de TAP-methode is de mogelijkheid tot automatisering. PCRs,
selectie van klonen en het opgroeien van culturen kan worden uitgevoerd door robots. Op
deze manier is analyse op grote schaal van proteomen technisch uitvoerbaar, de TAPmethode zou daarom een belangrijke techniek kunnen worden voor proteoom exploratie.
Gecombineerd met geautomatiseerde MS-analyse zal de hoeveelheid data voorhanden
over proteïne-interacties drastisch stijgen (Puig et al., 2001).
1.1.2.5. Multidimensional Protein Identification Technology (MudPIT)
In parallel met Y2H en proteïnechip technologie zal MS van proteïnecomplexen
gezuiverd d.m.v. enkele of tandem affiniteitstappen de nood aan complex specifieke
immunoglobulinen elimineren en maakt het de analyse van zeer kleine hoeveelheden op
een proteoom-wijde schaal mogelijk. Deze benadering kan uitgevoerd worden onder
fysiologische omstandigheden en vervangt de reconstructie van interactie netwerken uit
binaire interactie data. De Gavin et al,(2002) en Ho et al. (2002) studies gebruikten SDSPAGE om affiniteit-gezuiverde proteïnemengsels te scheiden voor MS-analyse. Daarbij
ontstonden problemen typisch gelinkt aan deze techniek, inclusief beperkingen in de
dynamische reikwijdte van detectie, variabele peptide elutie efficiëntie van de
polyacrylamide matrix en selectie tegen proteïnen met eigenschappen die analyse door
SDS-PAGE verhinderen (e.g. ongewoon hoge of lage moleculaire massa’s, diffuse
migratie, co-migratie met contaminanten en zwakke binding aan “stain”). Om deze
problemen te omzeilen demonstreerden McCormack et al. (1997) de mogelijkheid om een
digest van proteïnecomplexen te analyseren door rechtstreeks gebruik van een 1dimensionale vloeibare chromatografie. Een verbetering van deze methode, namelijk
Multidimensional Protein Identification Technology (MudPIT), breidde diens toepassing
uit naar grote proteïnecomplexen en is een betrouwbaar alternatief voor gel-afhankelijke
proteïnescheiding. MudPIT is afhankelijk van de digestie in een oplossing van het te
analyseren proteïnemengsel en van de scheiding van het resulterende complexe peptidemengsel door multidimensionele capillaire chromatografie in parallel met een ion trap
massaspectrometer. Deze techniek zorgt voor snelle identificatie van proteïnen die
interageren met de gemerkte “bait”. MudPIT is een interessant alternatief voor de
traditionele methoden voor snelle identificatie van eiwit-eiwit interacties voor
stoichiometrische en substoichiometrische partners. Peng et al. (2003) gebruikten een
multidimensionale benadering gelijkaardig aan MudPIT om honderden kandidaat
14
Deel 1: Literatuurstudie
geubiquitinyleerde proteïnen in “budding” gistcellen te identificeren. Graumann et al.
(2004) konden op een reproduceerbare manier betrouwbare partners voor het gist eiwit
Gcn5p (transcriptionele co-activator) identificeren. Ze pasten MudPIT ook succesvol toe
bij het snel screenen doorheen een collectie van gemerkte polypeptiden om nieuwe
proteïne-interacties te identificeren. Vijfentwintig proteïnen betrokken bij transcriptie en
progressie doorheen de mitose werden gemodificeerd met een nieuwe TAP-tag (9xHis – 2
PreScission protease klievingsplaatsen – 9xMyc). TAP-MudPIT analyses van 22
giststammen die deze gemerkte eiwitten expresseerden, brachten 21 interagerende
partners voor 21 van de baits aan het licht, een getal dat overeenkomt met de traditionele
technieken. Vergelijking van proteïnen geïdentificeerd via verschillende MudPIT-analyses
met verschillende baits uit verschillende subcellulaire compartimenten en pathways
maakten het uitfilteren van non-specifieke contaminanten mogelijk. Naast de proteïne
identificatie, kan een parallelle analyse van post-translationele modificaties worden
uitgevoerd. MudPIT in combinatie van MS zou van een gespecialiseerde analytisch
chemische omgeving naar een traditioneel celbiologie laboratorium kunnen getransfereerd
worden. Routine toepassing van MudPIT stelt celbiologen in staat om onderzoek te doen
naar dynamische veranderingen in proteïne interacties als antwoord op specifieke
chemische of biologische liganden, verstoring van het milieu of mutaties (Graumann et
al., 2004).
1.1.3. Blue-Native PAGE
Voor diepgaand onderzoek van eiwitcomplexen ontwikkelden Schägger et al. (2001) een
nieuwe, experimentele techniek om de individuele componenten van verschillende
eiwitcomplexen te onderzoeken. Door de combinatie van milde detergenten en de
kleurstof ‘Coomassie blue’, die het sterk denaturerend detergent SDS (sodium dodecyl
sulphate) vervangen, werd het voor het eerst mogelijk om intacte proteïnecomplexen te
scheiden via elektroforese. Refererend naar de blauw gekleurde gel en de zachte methode
van oplosbaar maken, waarbij natieve en enzymatisch actieve eiwitcomplexen bekomen
worden, werd deze techniek Blue Native-Polyacrylamide Gel Elektrophoresis (BNPAGE) genoemd.
BN-PAGE is een ladingsshift methode, waar de elektroforetische mobiliteit van een multiproteïne complex bepaald wordt door de negatieve lading van de gebonden Coomassie
kleurstof en de grootte en vorm van het complex. De samenstellende eiwitten van een
15
Deel 1: Literatuurstudie
complex kunnen in de tweede dimensie verder gescheiden worden via SDS-PAGE. De
samenstellende eiwitten van een complex worden op eenzelfde vertikale lijn gescheiden
en kunnen visualiseerd worden via kleuring van het gel. Spots kunnen uitgeknipt worden
en gesequeneerd via MS.
1.1.4. Yeast 2 Hybrid
Analytische studies van eukaryotische transcriptiefactoren waren de inspiratie voor de
ontwikkeling van het Yeast 2 Hybrid (Y2H) systeem. Men ontdekte dat het DNA-bindend
domein (BD) en het transcriptie-activatie domein (AD) van vele proteïnen functioneel en
fysisch gescheiden kon worden. Het BD gaat het proteïne op specifieke DNA-sequenties
binnen het genoom binden, terwijl het AD de transcriptie machinerie gaat activeren tot
gentranscriptie. Deze modulaire eigenschap werd verder gedemonstreerd wanneer een
actieve transcriptiefactor gecreëerd werd door fusie van BD van 1 proteïne aan de AD van
een niet gerelateerde proteïne. Later werd aangetoond dat de 2 domeinen niet aanwezig
moesten zijn op hetzelfde polypeptide.
Transcriptionele activatie onstaat enkel wanneer de 2 domeinen fysisch aan elkaar gelinkt
zijn (Figuur 1.6). Fields en Song (1989) ontdekten dat het mogelijk was om BD (bait) en
AD (fish of prey) van een transcriptiefactor samen te brengen door het fusioneren van elk
aan een paar van fysisch interagerende proteïnen. Deze ontdekking leidde tot het ontstaan
van het Y2H-systeem, een genetische methode van eiwit-eiwit interactie onderzoek.
Het Y2H-systeem kan gebruikt worden om cDNA-bibliotheken van AD-hybriden te
screenen voor identificatie van eiwitten die binden met het eiwit van interesse.
Er bestaan verschillende versies van Y2H met DNA-bindende domeinen die afgeleid zijn
van de gist GAL4-transcriptiefactor (GAL4-systeem) of het bacteriële repressor proteïne
LexA gebruikt in combinatie met E. coli B42 AD (LexA-systeem) (Causier, 2004).
Transcriptionele activatiedomeinen zijn afgeleid van het GAL4 proteïne of van het herpes
simplex virus VP16 proteïne.
Er worden verschillende rapporteergenen gebruikt, namelijk het E. coli LacZ gen en
selecteerbare gistgenen (HIS3, LEU2, ADE2). Er zijn verscheidene cDNA-bibliotheken
die als fusie met AD gekloneerd zijn, commercieel beschikbaar, zodat het screenen naar
eiwitinteracties in vele verschillende organismen of specifieke zoogdierweefsels mogelijk
is (Phizicky et al., 1995).
16
Deel 1: Literatuurstudie
Een variatie van Y2H is het Yeast Three-Hybrid systeem, deze wordt o.a. gebruikt voor de
identificatie van RNA-eiwit interacties. De algemene methode is dat een hybride RNA
bindt aan elk van de twee hybride eiwitten. Eens dit complex gevormd is wordt de
transcriptie van een reportergen geactiveerd. De expressie van het reportergen kan
fenotypisch geïdentificeerd worden of via een eenvoudige biochemische assay. Deze
techniek kan gebruik worden wanneer het RNA en eiwit beide gekend zijn of het kan
gebruik worden om een “partner” te identificeren wanneer enkel 1 component (RNA of
eiwit) gekend is (Zhang et al., 1999).
1.1.4.1. Voordelen en nadelen
Het Y2H systeem is zeer gevoelig en detecteert eiwit-eiwit interacties die niet door andere
methodes kunnen gedetecteerd worden. De minimale detecteerbare affiniteit-interactie zal
afhangen van variabelen zoals expressieniveau van de hybride proteïnen, het aantal, de
sequentie en de schikking van de DNA-bindende sites in het reportergen en de
hoeveelheid reporter proteïne nodig voor een detecteerbare fenotype.
Een ander voordeel is dat de interacties gedetecteerd worden in een cellulaire omgeving
en dus geen biochemische zuivering nodig is. Het gebruik van genetisch-gebaseerde
organismen zoals gistcellen als gastheercel voor het bestuderen van interacties laat toe
direct te selecteren voor interagerende proteïnen en te screenen voor een groot aantal
varianten om diegenen te detecteren die meer of minder sterk zouden kunnen interageren.
Het Y2H-systeem is gelimiteerd tot proteïnen die naar de nucleus getranslokeerd worden,
wat het gebruik ervan voor bepaalde extracellulaire proteïnen verhinderd. De proteïnen
moeten kunnen opgevouwen worden en stabiel kunnen zijn in gistcellen om hun activiteit
als fusieproteïnen te behouden. Interacties, afhankelijk van een posttranslationele
modificatie die niet voorkomt in gistcellen, zullen niet gedetecteerd worden (Phizicky et
al., 1995). Het bestuderen van planteneiwitten in gist lukt dan ook niet altijd.
Een groot nadeel is de hoge frequentie aan vals positieven, bvb. wanneer de target of bait
transcriptiefactoren zijn, zij bezitten dan namelijk reeds een DB en AD.
17
Deel 1: Literatuurstudie
Fig. 1.6: Twee hybriden worden geconstrueerd: cel a bevat een plasmide dat codeert voor een ‘DNA binding domain’ (BD) dat zal
fusioneren met een bepaald doelwitproteïne (target), cel alfa bevat een plasmide dat codeert voor een ‘activation domain’ (AD) dat
zal fusioneren aan een bepaald doelwitproteïne (bait). Bij interactie tussen beide cellen zal er trancriptionele activatie optreden
wanneer BD en AD elkaar herkennen. In dit geval wordt het lac-Z gen ook overgeschreven Dit gen codeert voor het enzym βgalactosidase, dat in staat is om de kleurloze stof X-gal om te zetten in een blauw gekleurd product.
Figuur overgenomen uit: http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/P/Proteomics.html
1.1.5. FRET (Fluorescence/Förster detected Resonance Energy Transfer)
Wegens de complexe organisatie en de compartimentalisatie van plantencellen is het zeer
waarschijnlijk dat moleculaire gedragingen in een testbuis verschillen met die in een cel,
daarom is het van essentieel belang om moleculen in hun natuurlijke omgeving te
bestuderen. Verschillende, innovatieve microspectroscopische benaderingen voorzien
zulke mogelijkheden, de hoge ruimtelijke resolutie van microscopie combinerend met
spectroscopische technieken, om zo informatie te bekomen over het dynamisch gedrag
van moleculen. Methoden om interacties te visualiseren kunnen gebaseerd zijn op FRET,
bvb. in fluorescentie lifetime imaging microscopie (FLIM).
18
Deel 1: Literatuurstudie
Bij het bestuderen van het gedrag van eiwitten met spectroscopische methoden is het
essentieel om de moleculen te merken met een fluorescente groep. Interactie tussen twee
eiwitten kan gevisualiseerd worden wanneer ze gemerkt zijn met de juiste fluoroforen.
Fig. 1.7: wanneer fusie-eiwit A-CFP interageert met B-YFP kan er fluorescentie resonantie energie transfer
optreden, detectie van de opgetreden emissie toont interactie tussen A en B aan.
Figuur overgenomen uit: http://meds.queensu.ca/qcri/greer/ri_pag.htm
Wanneer de fluoroforen in nauw contact komen met elkaar, kan energie getransfereerd
worden door een proces dat FRET (Förster, 1948) wordt genoemd (Figuur 1.7). Dit proces
is gebaseerd op het fenomeen dat de excitatie-energie van een donor naar een acceptor
molecule wordt overgedragen. FRET treedt op wanneer de emissie - en excitatie spectra
van het fluorofore paar overlappen en wanneer de afstand tussen de proteïnen zeer klein is
(maximaal 7 nm). Dus interacties tussen eiwitten in grote complexen of het binden van
moleculen aan grote transmembrane eiwitten kunnen moeilijk te observeren zijn. FRET is
dus ook een goede methode voor het bekomen van informatie over afstanden in
macromoleculaire complexen.
Fusieconstructen van de proteïnen van interesse met varianten van fluorescente proteïnen
kunnen genetisch bereid worden en intracellulaire interacties kunnen geregistreerd worden
d.m.v. FRET. Geschikte donor-acceptor paren zijn ‘cyan fluorescent protein’ (CFP) als
donor en ‘yellow fluorescent protein’ (YFP) als acceptor.
Een nadeel van FRET is de nood aan externe belichting om de fluorescentie-transfer te
initiëren wat kan leiden tot achtergrond storing wegens de directe excitatie van de
acceptor. Om dit probleem te omzeilen werd BRET (Bioluminiscence Resonance Energy
19
Deel 1: Literatuurstudie
Transfer) ontwikkeld. Deze techniek gebruikt het bioluminiscente luciferase ipv CFP om
de initiële foton-emissie, compatibel met YFP , te produceren.
Microspectroscopische technieken zijn in volle bloei, aangezien ze de enige methoden zijn
die ons toelaten binnen de levende cel te kijken (Hink et al., 2002).
1.1.6. Proteïne-microarray analyse
Het onderzoeksgebied van proteïne-microarray werd opgestart om het expressieprofiel
van proteïnen en hun functie te analyseren (MacBeath, 2002).
Om een proteïnechip (biochip) te maken worden natieve eiwitten of eiwitten die tot
expressie werden gebracht door genetische manipulatie, gezuiverd en geïmmobiliseerd op
een plaat. Arrays zijn een geordende opstelling van individuele stalen (bvb eiwitten), die
parallelle analyse van de stalen toelaat. Een hoge dichtheid proteïnechip (de analytische
efficiëntie is direct gerelateerd aan de dichtheid) kan gemaakt worden, wanneer proteïnen
gescheiden worden door 2D-elektroforese en via elektroblotting op de chip worden
aangebracht. Echter, chips, waarop de doelproteïnen rechtstreeks van de gel getransfereerd
kunnen worden, zijn voorlopig nog niet beschikbaar. High-throughput analyse van de
eiwit-eiwit interactie kan uitgevoerd worden wanneer de proteïnen die interageren met de
doelproteïnen op de chip geïdentificeerd worden door MS. De detectiemethode die
momenteel de voorkeur draagt is detectie m.b.v fluorescentie .
Proteïne-microarrays worden gebruikt voor de identificatie van eiwit-eiwit interacties,
voor de identificatie van substraten van proteïne-kinasen of voor de identificatie van
doelwitten van biologisch actieve, kleine moleculen.
Deze techniek heeft een groot potentieel voor de high-throughput analyse van proteïnen
interagerend met duizenden plantenproteïnen gescheiden door 2D-elektroforese. Het is
een belangrijk platform voor functional genomics en wordt tegenwoordig ook vaak
gebruikt in medische diagnostiek.
Proteïne-microarray analyse heeft te kampen met verschillende problemen, bijvoorbeeld,
sommige proteïnen veranderen van conformatie wanneer ze in contact komen met de chip
en verliezen zo hun activiteit. Het beschikbaar stellen van op kwaliteit geteste moleculen
voor immobilisatie is dus van primair belang. In vele gevallen is de oppervlakte van de
plaat chemisch gemodificeerd en zijn de proteïnen covalent geïmmobiliseerd met de
modificatie groep. Om deze techniek populairder te maken is het nodig om het materiaal
van de chip te verbeteren.(Hirano et al., 2004). Immobilisatie strategieën en inerte
20
Deel 1: Literatuurstudie
oppervlakken, geschikt voor het immobiliseren van eiwitten zonder interferentie, moeten
ontwikkeld worden. (Honoré et al., 2004)
Naast proteïnechips bestaan er ook chips voor antilichamen, antigenen, liganden en
koolhydraten (Figuur 1.8) (Zhu et al., 2003).
Fig. 1 8: Toepassingen van proteïne-microarrays. Er bestaan twee soorten, namelijk functionele en analytische arrays.
Fig overgenomen uit: www.stat.purdue.edu
1.1.7. Proteïne display
Display technologie refereert naar een verzameling van methoden voor het creëren van
bibliotheken van biomoleculen die gescreend kunnen worden voor de gewenste
21
Deel 1: Literatuurstudie
eigenschappen. Het is een routine methode geworden voor het verrijken van moleculaire
diversiteit en het produceren van nieuwe types van proteïnen. De combinatie van de steeds
groter wordende variëteit aan bibliotheken met de ontwikkeling van nieuwe benaderingen
om te selecteren voor een wijd arsenaal van gewenste eigenschappen, heeft op grote
schaal analyses van eiwit-eiwit en eiwit-substraat interacties, snelle isolatie van
antilichamen (of mimetisch antilichaam) zonder immunisatie en functie afhankelijke
proteïne-analyse vergemakkelijkt. Verschillende praktische en theoretische uitdagingen
moeten nog aangepakt worden voordat display technologie gemakkelijk kan toegepast
worden bij proteoom studies (Li, 2000).
Fig. 1.9: Een schematische diagram van een typisch display module en een lijst van de 4 grote display
systemen. (Li, 2000)
1.1.7.1. Faag display
Faag display maakt gebruik van de capaciteit van fagen om proteïnen gefusioneerd aan
een manteleiwit tot expressie te brengen op hun oppervlak (Mullaney et al., 2001). Door
het kloneren van bijvoorbeeld willekeurige oligonucleotiden in de coderende sequentie
van virale manteleiwitten, kan men een bibliotheek maken van virussen, waarin elk virus
een bepaalde peptidesequentie als deel van het manteleiwit presenteert (Figuur 1.9) (Li,
2000). Verschillende banken van genfragmenten of cDNA’s die coderen voor proteïnen of
proteïnedomeinen kunnen geëxpresseerd worden (Mullaney et al., 2001). Na constructie
van de faagbank wordt deze gescreend met een ligandproteïne of antilichaam om
22
Deel 1: Literatuurstudie
specifieke fagen die een bindingspartner expresseren te identificeren. Het antilichaam of
ligandproteïne wordt geïmmobiliseerd aan een vast materiaal. Fagen die niet binden
worden weggewassen, terwijl gebonden fagen geëlueerd worden en aangewend worden
voor re-infectie van E. coli. Door herhaalde cyclussen van affiniteitszuivering wordt een
hoge selectiviteit bekomen, ook bij het gebruik van grote en complexe banken.
Om bepaalde gewenste display voordelen te bekomen, werden verschillende virale
systemen gebruikt, waaronder lysogene filamenteuze fagen, lytische faag lambda, T7
bacteriofaag en T4 bacteriofaag.
1.1.7.2. Cel gebaseerde display (Li, 2000)
Bij cel gebaseerde systemen wordt een complementair DNA (cDNA) bibliotheek, die
codeert voor verschillende proteïnen, recombinant tot expressie gebracht in cellen en
gebeurt selectie via binding van een specifieke ligand op het celoppervlak.
Een cel gebaseerde display van grote cDNA bibliotheken in zoogdiercellen vereist
efficiënte gentransfer, bijvoorbeeld via een virale vector om DNA te introduceren. In gist
en andere prokaryotische systemen is dit een minder groot probleem, want daar gebeurt de
transformatie efficiënter. Bijvoorbeeld E. Coli flagelline 26 werd al gebruikt voor display.
In beide gevallen wordt de cellulaire gast gebruikt om de modulaire link te
bewerkstelligen tussen het coderende DNA en de tentoongestelde peptiden/proteïnen
(Figuur 1.9).
De waarde van het gebruik van cellulaire gastcellen wordt waarschijnlijk onderschat, want
het wordt steeds duidelijker dat post-translationele modificaties van biomoleculen
essentieel zijn voor hun functie.
1.1.7.3. Peptide-on-DNA/RNA display (Li, 2000)
Peptide-on-plasmid (DNA coderend) is een systeem waar een bibliotheek van plasmiden,
willekeurige peptiden gefusioneerd aan een DNA-bindend proteïne expresseert (Figuur
1.9). Omdat de peptide-DNA-bindende proteïnefusie in een gegeven bacterie gecodeerd
wordt door het corresponderende plasmide, laat de vorming van modulair gecodeerde
peptide-plasmide complexen toe te selecteren voor individuele peptiden van interesse door
de recuperatie van het gebonden plasmide.
23
Deel 1: Literatuurstudie
In tegenstelling tot de peptide-on-plasmide display start de polysoom display (RNA
coderend) met een pool van RNA gesynthetiseerd door transcriptie in vitro. Na in vitro
translatie onder de juiste condities, vormen de gesynthetiseerde peptiden een complex met
het coderende RNA via een niet-covalente of covalente chemische binding. Covalente
chemische binding wordt meestal bereikt door in vitro translatie uit te voeren met een
RNA-DNA fusie template waar elke peptide coderende RNA molecule in de bibliotheek
individueel gefusioneerd is aan een gemeenschappelijk ssDNA fragment waaraan
chemisch een puromycine werd vastgehecht. Onder deze omstandigheden komt de in vitro
translatie tot stilstand op het einde van het RNA open leesraam (ORF) en het RNA-DNA
knooppunt. Dit laat toe dat het cis-vastgehechte puromycine de ribosomale A-site betreedt
en een covalente link vormt met de C-terminus van de corresponderende, groeiende
peptideketen. Deze modulaire proteïne – DNA (of RNA) complexen in deze systemen zijn
vrij van de selectieve druk van biologische gastheren en bezitten de mogelijkheid tot
daaropvolgende biochemische of chemische modificatie van de peptiden.
24
Deel 1: Literatuurstudie
1.2. In silico predictie van eiwit-eiwit interacties
De ontwikkeling van systematische bioinformatica benaderingen, die de eiwitfunctie
kunnen bepalen en voorspellen en omschrijven hoe deze macromoleculen interageren
binnen complexe netwerken, is in volle opmars. Deze bioinformatica methoden bevatten
welbekende en nieuwe benaderingen, bvb. ‘data mining’, annotatie d.m.v. sequentie
gelijkenis, fylogenetische profilering, metabolisch pathway mapping, ‘gene neighbor’ en
domeinnaam fusie analysen.
1.2.1. Ontwikkelen van eiwit-eiwit interactie databases
Verschillende werkgroepen hebben geprobeerd databases van eiwit-eiwit interactie data te
compileren. Data opslagplaatsen zoals BIND, INTACT, DIP, GRID, SGD en HPRD
proberen de kennis van interagerende eiwitten te integreren in een gemakkelijk
toegankelijke database. Het primaire doel van deze databases is het extraheren en
integreren van de rijkdom aan informatie over eiwit-eiwit interacties beschikbaar in vele
verschillende wetenschappelijk journals en in archieven zoals MEDLINE. Deze databases
bieden ook hulpmiddelen aan voor het visualiseren van netwerken van interacties (bvb.
Cytoscape, Biolayout, Pathway Assist), voor het karteren van pathways doorheen
taxonomische takken en voor het genereren van informatie voor kinetische simulaties.
1.2.2. Computationele methoden
Voor het voorspellen van functionele associaties (inclusief directe binding), biedt de
recente stijging van volledig gesequeneerde genomen unieke mogelijkheden d.m.v. het
gebruik van zogenaamde genomische context of niet-homologie gebaseerde interferentie
methoden. Deze methoden steunen op het feit dat functioneel geassocieerde proteïnen
gecodeerd worden door genen die gelijkaardige selectiedrukken delen.
Marcotte et al. (1999) onderzochten op een computationele manier of eiwit-eiwit
interacties kunnen herkend worden uit genoomsequenties. Opmerkelijk is dat genen wiens
eiwitproducten nauw interageren in de cel vaak gefusioneerd voorkomen in 1 gen, dat
codeert voor een samengesteld polypeptide, waardoor de proteïnen een grotere kans
hebben om op een productieve wijze met elkaar te interageren. Op deze manier maakt
domeinfusie analyse twee verschillende voorspellingen. Het voorspelt enerzijds potentiële
eiwit-eiwit interacties en anderzijds voorspelt het eiwitparen die gerelateerde biologische
25
Deel 1: Literatuurstudie
functies hebben (bijvoorbeeld proteïnen die participeren in een gemeenschappelijke
structureel complex, metabolische pathway of biologisch proces).
De genetische vereiste om functioneel geassocieerde genen samen te houden wordt
duidelijk wanneer ze fylogenetische geconserveerd zijn. De genen hebben de neiging om
ofwel samen aanwezig of samen afwezig te zijn, d.w.z. ze hebben dezelfde fylogenetische
profielen. Dit is de computationele methode beschreven door Pellegrini et al. (1999) en
Huynen et al. (1998).
Bock en Gough (2001) ontwierpen een methode om de reikwijdte van de voorspellingen
uit te breidden naar volledige proteomen d.m.v. een computationeel statistisch “learning
theory”. In contrast met de hierboven vermelde theorieën, gebruikt de methodologie van
Bock en Gough een totaal andere benadering naar de computationele voorspelling van
eiwitinteracties. Met behulp van een database van gekende eiwit-eiwit interactieparen
werd een “machine learning system” getraind om interacties te herkennen die enkel
gebaseerd zijn op de primaire structuur en de geassocieerde fysiologische eigenschappen.
De voorspellingsmethodologie genereert een binaire beslissing over de potentiële eiwiteiwit interacties. Dit suggereert de mogelijkheid om startend van de geautomatiseerde
identificatie van de genproducten van een cel, de eiwit interactieparen af te leiden. Op
deze wijze vergemakkelijken we de identificatie van de functie van het proteïne en de
cellulaire signalisatie pathway.
Hoewel er veel moeite gestoken is geweest in methodes voor het identificeren van
interactie partners, heeft men minder de focus gelegd op het vergelijken van deze
interacties met die van 3-dimensionele (3D) structuren.
Databases, die verschillende methoden om eiwit interacties te voorspellen integreren,
werden ontwikkeld. Bijvoorbeeld, de STRING en POINT databases kunnen interacties
voorspellen tussen eiwitten (Droit et al., 2005).
26
Deel 1: Literatuurstudie
1.3. RNA-geïnduceerd Gene Silencing (Waterhouse et al., 2002)
1.3.1. Inleiding
Bij ‘reverse genetics’ gaat men uit van een gensequentie en wil men de functie van dit gen
bestuderen door de analyse van mutaties in dit gen. Een ‘reverse genetics’ benadering,
insertionele mutagenese genaamd, heeft een sleutelrol gespeeld in de studie van
Arabidopsis. Twee insertionele mutagenese strategieën werden in Arabidopsis
ontwikkeld, één gebaseerd op getransfereerd DNA (T-DNA) en één op transposon
tagging. Deze hebben geleid tot verscheidene grote, publiek toegankelijke collecties van
Arabidopsis insertiemutanten (bvb. Arabidopsis Stock Centre en de Salk Collectie in de
“The Arabidopsis Information Resource” (TAIR)).
Het gebruik van insertiemutanten heeft begrensde mogelijkheden. Men kan het
bijvoorbeeld niet gebruiken om de functies van gedupliceerde genen te onderzoeken, en
vele mutante fenotypes in deze lijnen worden veroorzaakt door disrupties in andere genen
dan deze waar de DNA-tag werd geïnsereerd.
Een benadering die deze begrenzingen omzeild is RNA-geïnduceerd gene silencing. In
planten wordt het post-transcriptional gene silencing (PTGS) genoemd, in fungi quelling
en RNA-interferentie (RNAi) in dieren.
De essentie van RNA-geïnduceerd gene silencing is de introductie van dubbelstrengig
RNA (dsRNA) in een organisme of cel om zo een sequentie specifiek RNA
degradatiemechanisme te induceren dat op effectieve wijze het doelwitgen afbreekt.
Wanneer natuurlijk voorkomend viraal RNA (dat dsRNA produceert tijdens de replicatie)
of zelfcomplementair, enkelstrengig “hairpin” RNA (hpRNA) of dsRNA, geïntroduceerd
wordt in een plant, wordt het afgebroken via DICER tot 21 nucleotiden lange dsRNA
fragmenten, beter gekend als “small interfering RNA” (siRNAs). Deze siRNA fragmenten
worden gebonden door een nuclease bevattende complex, RISC (RNAi-silencing
complex) genaamd. Deze degradeert mRNA’s die complementair zijn met de
enkelstrengige siRNA dat geassocieerd is met het complex (Figuur 1.10).
Een belangrijk aspect van het gebruik van RNAi in plantengenoom onderzoek is de
introductie van het silencing-inducerende dsRNA of hpRNA in de cel. Dit RNA kan
geleverd worden aan de plantencel door stabiele transformatie van de planten met
transgenen die coderen voor hpRNA’s of virale RNA’s. Het kan ook transiënt geleverd
worden aan de plantencel door de planten te bombarderen met nucleïnezuur-beklede
27
Deel 1: Literatuurstudie
parels, door infectie van plantencellen met transgene Agrobacterium tumefaciens of door
infectie van planten met een virus en eventueel een satelliet virus wanneer nodig.
Elk methode heeft zijn voor- en nadelen.
Fig. 1.10: Het model van RNA-gemedieerde gensilencing in planten. Dit model is gebaseerd op resultaten van in
vitro RNAi studies in dierenextracten. Men denkt dat RNAi bij planten op dezelfde manier werkt, omdat siRNA
werd gevonden in planten en planten bezitten homologen van het dierlijke DICER-gen (Waterhouse et al.,
2003).
1.3.2. Microprojectiel bombardement en agro-infiltratie
Het bombarderen van plantenweefsel met goud - of wolfraampartikels bekleed met DNA,
wordt vaak gebruikt bij studie van genexpressie in planten en voor de transformatie van
verscheidene monocotyle plantspecies zoals rijst (Oryza sativa). Het DNA of RNA dat elk
partikel bekleedt wordt vrijgelaten en geëxpresseerd in de cellen waar het partikel in
terecht komt.
Wanneer Agrobacterium tumefaciens een plant infecteert, transfereert het delen van diens
T-DNA plasmide naar het genoom van de geïnfecteerde plantencellen.
Infiltratie van de bladeren met een cultuur van Agrobacterium waarvan het Ti-plasmide
het transgen bevat dat codeert voor een endogene plantengensequentie, kan RNAi
triggeren tegen het endogene doelwitgen. In de eerste dagen na infiltratie wordt GFP
28
Deel 1: Literatuurstudie
overgeëxpresseerd op de plaats van infiltratie, maar na ongeveer drie dagen vervalt deze
expressie tot ondetecteerbare niveau’s samengaand met de reductie van endogene
doelwitgenexpressie. Deze lokale co-suppressie verspreidt zich doorheen de plant.
Op eenzelfde manier, maar sterker, bekomt men co-suppressie met T-DNA’s die hpRNA
coderende sequenties bevatten.
1.3.3. Virus geïnduceerde co-suppressie (VIGS)
Virussen hebben verschillende eigenschappen die hen bruikbaar maken voor
plantenonderzoekers. Het naakte virale RNA van verschillende plantenvirussen kan
gebruikt worden in planten om infecties te voorkomen (Waterhouse et al., 2003). Bij
VIGS wordt een gensequentie naar keuze ingebracht in een viraal genoom. Infectie van de
plant met het gemanipuleerde virus leidt dan tot de systemische silencing van het
homologe plantengen. Bijvoorbeeld een plant geïnfecteerd met Potato Virus X (PVX) die
een fragment van het phytoene desaturase (PDS) mRNA bevat leidt tot sterk verbleekte
bladeren in het bovenste gedeelte van het geïnfecteerde plant. De oorzaak van deze
symptomen is de daling in het niveau van het endogene PDS mRNA wat resulteert in lage
hoeveelheden van PDS. Hierdoor stopt de carotenoïd productie en is de plant niet meer
beschermd tegen verbleking o.i.v. licht (Baulcombe, 1999).
Het mechanisme van VIGS is RNA silencing en is een mechanisme van de plant om
virussen te bestrijden (RNA-gemedieerd defensie mechanisme).
Een volledige virus cDNA kloon kan geïnsereerd worden in een Ti-plasmide,
geëxpresseerd onder invloed van een cauliflower mozaïek virus (CaMV) 35S-promotor en
in de plant gebracht worden door agroinfiltratie. Zo kan een virusinfectie voorkomen
worden d.m.v. RNAi wanneer het T-DNA door de plant wordt overgeschreven.
1.3.4. Amplicon en hairpin RNA transgenen
Amplicon en hpRNA-transgenen worden stabiel getransformeerd in planten en ze zorgen
ervoor dat de RNAi die ze induceren overgeërfd wordt door de opeenvolgende generaties.
Een amplicon codeert voor een virusafgeleid transcript dat een doelwit gensequentie
bevat, maar niet noodzakelijk alle virale genen. Het controleert diens eigen replicatie. Het
transgeen staat meestal onder controle van de CaMV 35S promotor zodat het amplicon
29
Deel 1: Literatuurstudie
RNA tot expressie komt in bijna elke cel van de plant. De getransfecteerde planten
vertonen geen symptomen van virusinfectie.
De meest efficiënte methode voor ‘knock down’ van plantgenen d.m.v. posttranscriptionele silencing is het expresseren in transgene individuen van hpRNA
opgebouwd uit een dubbelstrengige stam met een fragment van het transcript dat
geviseerd wordt voor afbraak en een loop met intron sequenties die uit de RNA molecule
worden gesplicet (Figuur 1.11) (Hilson et al., 2004).
Fig. 1.11: Een typisch DNA construct voor de expressie van hpRNA’s. Het bevat het “target sequence” in de sense en
antisense richting gescheiden door een intron, dit zal via complementaire baseparing resulteren in een hpRNA. Ook een
selectiemerker, bvb. GFP is aanwezig voor de selectie van plantencellen die het T-DNA met het DNA construct voor
RNAi hebben opgenomen. (Waterhouse et al., 2003).
1.3.5. Transcriptionele co-suppressie
Een recentelijk ontdekte eigenschap van RNAi in planten is dat dsRNA sequentiespecifieke DNA-methylatie veroorzaakt. Co-suppressie door VIGS of hpRNA constructen
gaat vaak gepaard met methylatie van de coderende regio van het doelwitgen, dit heeft
normaal geen direct effect op de transcriptie. Maar in drie RNAi studies in planten, was
een genpromotor het doelwit en dit resulteerde in deze gevallen in promotor methylatie.
Deze promotor methylatie of verandering in chromatine conformatie vanwege de
methylatie van de promotor, affecteert waarschijnlijk de binding van transcriptiefactoren
wat leidt tot gereduceerde transcriptie.
1.3.6. Toepassing van RNAi in TAP, de iTAP-strategie (Forler et al., 2003)
Dit is de TAP-technologie gecombineerd met RNAi om zo competitie van het
corresponderende endogene proteïne te verhinderen. Hierbij wordt het endogene gen
getarget voor afbraak via RNAi, terwijl het transgene ‘TAP-tagged’ gen onaangeroerd
blijft.
De iTAP-strategie leidt tot een hogere opbrengst en specificiteit van de zuivering,
daarnaast laat het ook toe onderscheid te maken tussen specifieke en non-specifieke
bindingen. De toepassing van de iTAP-techniek laat ons ook toe te controleren of de
30
Deel 1: Literatuurstudie
gemerkte proteïnen functioneel zijn. Voor essentiële proteïnes laat iTAP-strategie toe te
selecteren voor cellen die gemerkte proteïnen bevatten in hoeveelheden die de
levensvatbaarheid herstellen.
1.3.7. Vectoren voor RNAi
De pHELLSGATE & pTRV-att P/R vectorenserie gebruikt de snelle, op recombinatie
gebaseerde, GatewayTM Technologie. Deze vergemakkelijkt de high-throughput klonering
en manipulatie van genbibliotheken die nodig zijn voor de vorming van RNAiconstructen. Deze methode is praktisch voorlopig enkel uitvoerbaar bij Arabidopsis
thaliana. Verschillende onderzoeksgroepen zijn bezig met het produceren van middelen
die nodig zijn om RNAi te gebruiken als techniek voor high-throughput plantgenoom
onderzoek. De CATMA groep (Complete Arabidopsis Transcriptome MicroArray) is
bezig met de ontwikkeling van een set van PCR producten , gene-specific sequence tags
(GSTs), die elk Arabidopsis gen voorstellen. Ze kunnen gereamplificeerd en gekloneerd
worden in Gateway vectoren via de BP-recombinatie reactie.
Het AGRIKOLA consortium (Arabidopsis Genomic RNAi Knock-Out Line Analysis)
gebruikt deze set van PCR-produkten om in pHELLSGATE vectoren via LRrecombinatie reactie (Figuur 1.12) een genspecifiek RNAi-construct voor elk Arabidopsis
gen te genereren, zodat ze op grote schaal in RNAi co-suppressie studies gebruikt kunnen
worden.
Fig. 1.12: Via BP-reactie wordt een entry-kloon gegenereerd met het gen van interesse, die dan vervolgens via de LR
reactie kan gekloneerd worden in een hpRNA-vector of in een VIGS-vector (Waterhouse et al., 2003).
31
Deel 1: Literatuurstudie
1.4. Optimalisatie van transgenexpressie via toevoegen van introns
Een basiseigenschap van de meeste eukaryotische genen is dat ze onderbroken worden
door 1 of meer introns, die na transcriptie verwijderd moeten worden om mRNA’s te
vormen met intacte open leesramen. Sinds hun ontdekking is er veel gedebatteerd over
hun evolutionaire oorsprong en hun functies. Functies die reeds vroeg werden ontdekt zijn
de vergemakkelijking van het evolueren van nieuwe genen door “exon shuffling” of
duplicatie en expressie van meerdere proteïnen vanuit 1 enkele gen door alternatieve
splicing. Tegenwoordig wordt het steeds duidelijker dat introns en hun verwijdering door
het spliceosoom vele andere fases van het mRNA metabolisme kunnen beïnvloeden,
inclusief de initiële transcriptie van een gen, editing en polyadenylatie van het pre-mRNA,
nucleaire export, vertaling en afbraak van het mRNA product. Samen zorgen deze
effecten voor een mogelijk verschil in expressie profielen van intron-bevattende en
intronloze versies van hetzelfde gen. Alhoewel er geen universele vereiste is aan intronen
voor eukaryotische genexpressie, kan de expressie van een transgeen aanzienlijk worden
verhoogd door de toevoeging van 1 generisch intron aan het cDNA (Hamer et al., 1979;
Gruss et al., 1979; Palmiter et al., 1991).
Het werd aangetoond dat introns de transcriptionele efficiëntie van vele genen in een
variëteit aan organismen beïnvloeden. Bijvoorbeeld, een vroege studie toonde aan dat
intronloze transgenen in muizen 10 tot honderd maal minder efficiënt worden
overgeschreven dan hun intron-bevattende tegenhangers (Brinster et al., 1988).
Een manier waarop introns transcriptie kunnen beïnvloeden is door op te treden als
opslagplaats voor transcriptionele regulatorische elementen, zoals enhancers en
repressoren (Figuur 1.13).
Een intron kan de transcriptie reguleren door controle van de DNA toegankelijkheid door
modulatie van nucleosoom positie. Eens het DNA is overgeschreven stimuleren de
splicing signalen in een intron verder de transcriptie door het verbeteren van RNA pol II
initiatie en processiviteit (Figuur 1.13).
In gist - en zoogdiercellen kunnen promotor proximale introns de transcriptie initiatie
verhogen. U1 small nuclear RNA (snRNA), een goed gekende effector van 5’ splice site
herkenning, associeert met algemene transcriptie initiatiefactor TFIIH en is nodig voor de
stimulerende effecten van een promotor-proximaal intron op RNA pol II re-initiatie (Le
Hir et al., 2003).
32
Deel 1: Literatuurstudie
Terwijl specifieke regulatorische elementen worden gevonden in sommige introns, ziet
men een meer algemene intron-gemedieerde verhoging (intron mediated enhancement,
IME) als resultaat van synergistische interacties tussen factoren die optreden in de
verschillende stappen van genexpressie van transcriptie tot translatie.
De stabiliteit van het mRNA van een gen met of zonder intron is gelijk, wat er op wijst dat
introns mRNA accumulatie eerder verhogen door stijging van de productie dan door
daling van afbraak.
De gestegen translationele efficiëntie is te wijten aan een gestegen associatie van het
mRNA met ribosomen via interacties met de proteïnen van het “exon junction complex”
(EJC), die 20 tot 24 nucleotiden stroomopwaarts van het intron in het mRNA worden
afgezet gedurende de splicing.
Het blijft onduidelijk of de predominante mechanismen waarmee introns de genexpressie
beïnvloeden dezelfde zijn in alle organismen of dat ze kunnen verschillen tussen introns in
één enkele species. Niettemin, de gelijkheden in de geobserveerde eigenschappen van
IME suggereren dat op zijn minst sommige eigenschappen wijd geconserveerd zijn. In
tegenstelling tot transcriptionele enhancers, moeten de meeste introns gelokaliseerd zijn
binnenin de overgeschreven sequentie om mRNA accumulatie te verhogen in planten en
zoogdieren. Echter, de toevoeging van een intron in het primaire transcript is vaak niet
genoeg voor IME, aangezien het vermogen van vele introns om de expressie te stimuleren
sterk daalt of volledig verloren gaat wanneer deze geplaatst wordt in de 3’UTR
(untranslated region). Op 3’ locaties zijn introns beduidend minder effectief bij het
verhogen van de expressie, dan wanneer ze dichtbij het begin (5’ uiteinde) van het gen
gelegen zijn.
Een daling in het vermogen van een intron om expressie te stimuleren wanneer het
geplaatst wordt dichtbij het 3’ uiteinde van een transcript werd waargenomen in HeLa
cellen, Xenopus, Arabidopsis, rijst en maïs. De diversiteit aan species waar het
waargenomen werd suggereert dat de afhankelijkheid van intron lokalisatie een
geconserveerd mechanisme van IME weerspiegelt.
Hoewel geweten is dat introns op eender welk uiteinde van een gen verschillen in graad
waarmee ze de expressie stimuleren, werd het effect van het variëren van de positie van
een enkel intron niet stelselmatig getest in eender welk organisme. De aard van de afname
in IME wanneer een intron in een gen wordt verplaatst zou moeten helpen om de
verschillende modellen te onderscheiden die zouden kunnen uitleggen waarom introns de
33
Deel 1: Literatuurstudie
mRNA-accumulatie verhogen aan het begin van een gen en niet aan het einde van de gen
(Rose, 2004).
Fig.1.13: Introns kunnen de efficiëntie van transcriptie beïnvloeden op verschillende manieren. Transcriptionele
enhancers of repressoren, of nucleosoom positionerende elementen binnenin de introns kunnen de efficiëntie van
transcriptie initiatie beïnvloeden. Spliceosoom componenten (groen) die assembleren op een nieuw overgeschreven
intron kunnen verder de transcriptie verhogen op niveau van initiatie en elongatie. Figuur overgenomen uit Le Hir et al.
(2003).
1.4.1. Studies in planten
Het testen van het vermogen van een intron om de expressie te verhogen van een
reportergen toonde aan dat introns genexpressie stimuleren op 2 niveau’s in Arabidopsis.
Het grootste effect was zichtbaar op gebied van mRNA-accumulatie. De grootte van deze
verhoging verschilde tussen introns, maar was afhankelijk van de nabijheid van het intron
tot de promotor voor de TRP1 (Tryptophan Biosynthesis 1 gen) en UBQ10
(PolyUbiquitine 10 gen) introns. In mindere mate kunnen de meeste introns ook de
translationele opbrengst verhogen omdat de IME op niveau van proteïne-activiteit
ongeveer 2 maal groter was dan die gemeten op het niveau van mRNA-accumulatie,
ongeacht van de positie of identiteit van het intron. Deze bevindingen steunen op het
model dat introns transcriptie stimuleren en ook dat de EJC translatie verhoogt in planten
(Rose, 2004).
Observaties gedaan door Rose (2002) bij zijn experimenten met het PAT1-intron1 in
Arabidopsis suggereren dat, alhoewel splicing niet per se essentieel is voor IME, de
intronsequenties moeten interageren met de splicing-machinerie om de mRNAaccumulatie te verhogen.
Studies gedaan door Alexandrov et al. (2006) in Arabidopsis tonen aan dat genen met
minder dan 4 introns gereduceerde gemiddelde mRNA niveaus vertonen.
34
Deel 1: Literatuurstudie
Verhoging van genexpressie door introns is geen algemeen fenomeen aangezien bepaalde
natuurlijk voorkomende genen geen introns bevatten en efficiënt worden geëxpresseerd,
terwijl sommige intron-inserties in transgenen niet leiden tot verhoging van expressie. In
planten wordt verhoging van genexpressie alleen geobserveerd in de meer GC-rijke
(monocotyle) genomen. Meer nog, er werd geobserveerd dat variatie in expressieniveau’s
zelfs gevonden kan worden in verschillende weefsels binnenin een enkele plant en dat
IME een genafhankelijk proces zou zijn (Bourdon et al., 2001).
Recente vorderingen in gentransfer naar plantencellen en de ontwikkeling van
verschillende reportergenen, maken het mogelijk om de expressie van vreemde genen in
mono- en dicotyle plantencellen kwantitatief te onderzoeken. Zo werd het eerste intron
van het wonderboon catalase gen, cat-1, geplaatst in de N-terminale regio van de
coderende sequentie van het -glucuronidase gen (gus A), het intron-bevattende gus A
werd gefusioneerd met de Cauliflower mosaic virus (CaMV) 35S-promoter. Het plasmide
met dit construct werd gebruikt om het effect van het intron op de expressie van glucuronidase (GUS) activiteit te onderzoeken in transgene rijst calli en planten
(monocotylen) en in transgene tabaksplanten (dicotylen). Het intron-bevattende plasmide
verhoogde het niveau van GUS-enzymactiviteit in vergelijking met het intronloze
plasmide, 10 tot 40-voudig en 80 tot 90-voudig in transgene rijst protoplasten en transgene
rijstweefsels respectievelijk. In contrast hiermee beïnvloedde de aanwezigheid van het
intron amper de expressie van de GUS-activiteit in transgene tabaksplanten. Northern blot
analyse toonde aan dat het catalase intron efficiënt werd gesplicet in rijstcellen, terwijl
transgene tabaksplanten even grote hoeveelheden gesplicete en ongesplicete gus A
transcripten bevatte. Het verschil in het effect van het intron op soortvreemdegenexpressie in deze twee species is gecorreleerd met het verschil in de hoeveelheid van
matuur gus A transcript geproduceerd in transgene planten en de efficiëntie van
intronsplicing.
De studies gedaan door Tanaka et al. (1990) suggereren dat de machinerie gebruikt voor
de processing van pre-mRNAs zou kunnen verschillen in elke plantenspecie en dat de
efficiëntie waarmee een soortvreemd intron wordt gesplicet, beïnvloed wordt door
verschillende factoren zoals de sequentie van het intron, de sequentie van het exon dat het
intron flankeert en de locatie van het intron binnenin een gen (Tanaka et al., 1990).
35
Deel 2: Doelstelling
Deel 2: Doelstelling
Uit onderzoek weet men dat de eukaryote cel op moleculair niveau zeer sterk georganiseerd
is. De meeste cellulaire processen worden niet gereguleerd door een reeks eiwitten die
onafhankelijk van elkaar werken, maar eerder door eiwitcomplexen. Om deze reden wordt er
in de onderzoeksgroep Functionele Proteoomanalyse een technologisch platform ontwikkeld
dat moet toelaten om op efficiënte wijze eiwitcomplexen uit plantencellen te isoleren en te
analyseren. Als modelsysteem wordt de celcyclus gebruikt. De celcyclus staat onder controle
van een universeel geconserveerde moleculaire machinerie. De complexe macromoleculaire
stappen van de eukaryotische celcyclus wordt gereguleerd door een klein aantal heterodimere
proteïne (serine/threonine) kinasen, deze bevatten een regulatorische subunit (cycline) en een
katalytische subunit (cycline dependent kinase CDK). Deze CDK/cycline complexen worden
op hun beurt op verschillende manieren en niveau’s gecontroleerd door onder andere
posttranslationele modificaties zoals fosforylaties, interacties met andere eiwitten,
subcellulaire herlocalisatie en eiwitafbraak. De opheldering van de samenstelling en regulatie
van CDK/cycline complexen enerzijds en hun functie tijdens de celcyclus anderzijds is
essentieel om te komen tot een fundamenteel begrip van de celcyclus progressie in planten en
de rol van celdeling in de ontwikkeling van de plant.
Om te komen tot een succesvolle studie van eiwitcomplexen in de plantencelcyclus, is er een
bruikbaar modelsysteem nodig. In volledige plantextracten is het gehalte aan eiwitcomplexen
die de celcyclus controleren zeer laag. Daarom wordt er gebruik gemaakt van een
celsuspensiecultuur van Arabidopsis. Op deze manier bekomen we snel een voldoende massa
delende cellen.
Voor de isolatie van de complexen wordt gebruik gemaakt van een nieuw ontwikkelde
techniek, nl. tandem-affiniteitszuivering (TAP). Eiwitten worden tot expressie gebracht als
een fusieproteïne met twee verschillende tags, wat een zeer selectieve twee-stapszuivering
toelaat van de complexen waar de geTAP-tagde eiwitten deel van uitmaken. Vervolgens
worden de complexen gescheiden via 1D- of 2D-elektroforese en de eiwitten worden
geïdentificeerd via massaspectrometrie (MS). Dit gebeurt door de eiwitspots of bandjes uit het
gel te knippen, het geëlueerde eiwit te digereren tot peptiden en via MS een massaprofiel van
de peptiden te bekomen. Dit profiel wordt vergeleken met een database van voorspelde
eiwitprofielen, waarbij een match leidt tot identificatie van het eiwit.
Daar er in planten nog geen technologie voorhanden is die homologe recombinatie toelaat,
zoals in gist, zal er altijd competitie zijn tussen het recombinante fusie-eiwit en het endogene
36
Deel 2: Doelstelling
eiwit voor inbouw in een eiwitcomplex. Optimalisatie van de expressie van het recombinante
fusie-eiwit en een daling van de expressie van het corresponderende endogene eiwit, kan
leiden tot een verhoogde competitie en bijgevolg een hoger aantal complexen die het fusieeiwit bevatten.
In deze thesis proberen we de expressie van ons ‘TAP-tagged’ fusie eiwit te verhogen door
het behouden van diens intronen en dus niet te werken met cDNA. We proberen ook de
expressie van het endogene gen te verlagen door het endogene mRNA gericht af te breken via
een silencing mechanisme opgewekt door een hairpin-RNA dat het 3’UTR target. Een derde
luik van deze thesis is het vergelijken van C-terminale versus N-terminale TAP-fusies.
Tagging aan de C- of N-terminus kan soms interfereren met de functie van het eiwit of met de
inbouw in complexen. Een vergelijking tussen de twee tagging-strategieën, kan een indicatie
geven van welke strategie het best toegepast wordt, rekening houdend met een zekere ‘bait’afhankelijkheid.
37
Deel 3: Materiaal en Methoden
Deel 3: Materiaal en Methoden
3.1. Gebruikte stammen en cellen
3.1.1. Bacteriële stammen

Escherichia coli DB3.1: Deze stam bevat het gyrA462 allel dat resistentieverleent
tegen de toxische effecten van het ccdB gen.
Genotype: F- gyrA462 endA1 glnV44 Δ(sr1-recA) mcrB mrr hsdS20(rB-, mB-) ara14
galK2 lacY1 proA2 rpsL20(Smr) xyl5 Δleu mtl1

Escherichia coli DH5: Deze stam is sensitief voor de toxische effecten van het
ccdB gen.
Genotype: F-φ80dlacZΔM15 Δ(lacZYA-argF)U169 deoR, recA1 endA1 hsdR17(rk mk+ phoA supE44 λ- thi-1 gyrA96 relA1

Agrobacterium tumefaciens stam C58C1RifR pMP90: gebruikt om plantencellen te
transformeren.
3.1.2. Plantencellen
We gebruikten de Arabidopsis thaliana PSB-d cellen (May and Leaver, 1993). De cellen
werden in het donker opgegroeid bij 25°C, 130 rpm en om de 7 dag gesubcultiveerd (1 op 10)
(Menges and Murray, 2002).
3.2. Groeimedia
Alle media worden geautoclaveerd en bewaard op kamertemperatuur. Vanaf dat vitaminen of
eventuele antibiotica worden toegevoegd dient het bewaard te worden bij 4°C. Deze worden
pas toegevoegd nadat het media geautoclaveerd werd. Alle media kunnen zowel vloeibaar als
vast bereid worden. Bij het bereiden van vast medium wordt agar toegevoegd, voordat het
medium wordt geautoclaveerd. Nadien wordt het medium in petriplaten gegoten en afgekoeld
totdat de agar gestold is.
38
Deel 3: Materiaal en Methoden

LB (Luria Bertani) is het groeimedium waarin de E. coli in optimale omstandigheden
en bij een optimale temperatuur (resp. 37°) kunnen opgroeien.
Het vloeibare LB-groeimedium bestaat uit (Sambrook et al.):
-
10 g/l NaCl
-
10 g/l Bacto trypton
-
5 g/l Bacto-Yeast extract.
LB+ medium bevat ook nog 0,1% glucose.
Alle groeimedia worden gesteriliseerd in de autoclaaf en antibiotica worden
toegevoegd bij een temperatuur lager dan 50°C (wegens hitte-instabiliteit van
antibiotica).
Voor o.a. het bewaren van culturen, platen we deze uit op petriplaten met vast medium.
Het vaste medium bestaat uit (Sambrook et al., 1989):
- LB+
- 20 g/l agar

Bij ‘heatshock’-transformatie gebruiken we SOC-medium, dit is een bufferend
medium dat veelal gebruikt wordt om maximale transformatie efficiëntie te bekomen
in E. coli.
100 ml SOC-medium bestaat uit:
- 97 ml H2O
- 2 g Bacto Tryptone
- 0.55 g Bacto Yeast Extract
- 1 ml 10 mM NaCl
- 1 ml 10 mM KCl
Het geheel wordt gesteriliseerd. Hierna wordt het afgekoeld tot 55°C. 1 ml 2 M Mg ++
(1 M MgCl2, 1 M MgSO4) en 1 ml 2 M glucose worden toegevoegd. De pH van het
SOC-medium moet ongeveer 7 zijn en steriele filters worden gebruikt om de oplossing
finaal steriel te maken.

Voor het opgroeien van BAC-clones gebruiken we Terrific Broth (TB) groeimedium.
- 24 g Bacto®-Tryptone
- 48 g Bacto®-Yeast Extract
- 8 ml 100 % glycerol
- voeg H2O toe aan 1.8 L en autoclaveer
39
Deel 3: Materiaal en Methoden
We voegen nog antibiotica toe, namelijk enerzijds chlorampfenicol (stock: 12,5
mg/ml, finale concentratie: 25 g/ml) en kanamycine (stock: 12,5 mg/ml, finale
concentratie: 25 g/ml).

SOB-medium 1L: wordt gebruikt voor de bereiding en transformatie van heat shock
competente E. coli cellen (Hanahan, 1983).
-
20 g tryptone
-
5 g gist extract
-
0.5 g NaCl
Autoclaveren. Voor gebruik: Voeg 10 ml van filter gesteriliseerde 1M MgCl2

YEB-medium: wordt gebruikt voor het opgroeien en transformatie van Agrobacterium
tumefaciens cellen.
-
0,5% beef extract (=lab lemco) 5g
-
0,1% gist extract 1g
-
0,5% peptone 5g/l
-
0,5% sucrose 5g/l
-
2mM MgSO4(2ml/l < 1M stock)
Nadat deze componenten goed gemengd zijn, wordt de pH ingesteld op 7,2. Daarna
wordt dit medium geautoclaveerd.
Voor o.a. het bewaren van culturen, platen we deze uit op petriplaten met vast medium.
Het vaste medium bestaat uit: YEB + Agar (1,5% agar LabM).

MSMO (1L) medium: Gebruikt voor de transformatie en groei van Arabidopsis
thaliana (PSB-d stam) celculturen.
-
4,43g MSMO (minimal organic Sigma #M6899)
-
30g Sucrose
-
500 l NAA (1mg/ml stock in 100mM NaOH)
-
50 l Kinetine (1mg/ml stock in DMSO)
Pas de pH aan tot 5,7, gebruik hiervoor 1 M KOH.

MSMO – agar (0,8%) + Km (50 g/ml), Cb (500 g/ml), Vancomycine (500 g/ml)
Per liter medium:
-
8 g agar (Plant Tissue Culture, Lab M)
40
Deel 3: Materiaal en Methoden
-
4 ml Km (stock 12,5 mg/ml)
-
10 ml Cb (stock 50 mg/ml)
-
10 ml Vancomycine (stock 50 mg/ml)
3.3. Vectoren
Voor het kloneren en het tot expressie brengen van een gen kunnen verschillende soorten
klonerings- en expressievectoren gebruikt worden.
3.3.1. pDONRTM221 (Invitrogen)
Deze vector (Figuur 3.1) dient als ‘entryclone’ in het Gateway® kloneringsysteem. Vanuit
deze vector kunnen gewenste DNA-fragmenten gekloneerd worden in verschillende
‘destination’ vectoren. Deze vector bezit de volgende belangrijke kenmerken:

rrnB T1 en T2 transcriptieterminators:
beschermen het gekloneerde gen van
expressie
door
vector-gecodeerde
promotors, om mogelijke toxiciteit te
reduceren.

M13 ‘forward’ en M13 ‘reverse priming
site’:
laat
sequenering
toe
in
respectievelijk de sense en de anti-sense
oriëntatie.

attP1
en
Lambda
attP2
sites:
Bacteriofaag
afkomstige
recombinatiesequenties
DNAdie
Fig. 3.1: schematische weergave: pDONR221TM
Gateway® ‘entryclone’ vector
(Invitrogen).
recombinatoriële klonering toelaten van het gen van interesse vanuit een attB
bevattend attB-PCR product.

ccdB-gen: laat negatieve selectie toe voor het plasmide na recombinatie en
daaropvolgende transformatie. Het ccdB proteïne interfereert met het E. coli DNA
gyrase, waarbij de groei van de meeste E. coli stammen wordt geïnhibeerd. Bij
recombinatie wordt het ccdB gen vervangen door het gen van interesse en kan de cel
waarbij de recombinatie succesvol verlopen is groeien.

kanamycine resistentiegen: laat selectie toe voor het plasmide in E. coli.
41
Deel 3: Materiaal en Methoden

CmR gen: nodig voor de propagatie van donor vectoren (geeft zekerheid over de
aanwezigheid van de Gateway-cassette )
pDONRTM207 werd ook gebruikt, het enige verschil met pDONRTM221 is dat pDONRTM207
een gentamycine resistentiegen bevat in plaats van een kanamycine resistentiegen.
3.3.2. pDonrP4P3
De pDonrP4P3 vector bezit dezelfde backbone als pDonr 221, maar heeft een ander gatewaycassette, nl. de att-sites attP4 en attP3 . In deze vector werd de ‘cauliflower mozaic’ virus
35S-promotor gekloneerd. Deze entry-vector werd dan gebruikt om de 35S-promotor te
kloneren in een N-terminale TAP-destination-vector.
3.3.3. pAGRIKOLA
De pAgrikola vector (Hilson et al., 2004) bevat 2 gateway-cloneringscassettes en wordt
gebruikt voor het maken van hairpin-constructen (Figuur 3.3). Het RNAi-construct
pAgrikola-3’UTR (anti-sense en sense) CDKA;1 (Figuur 3.2) werd geconstrueerd om RNAgeïnduceerd ‘gene silencing’ in onze plantencellen op te wekken.
Wegens de dubbele LR-recombinatie reactie kunnen verschillende intermediairen ontstaan,
afhankelijk van welke repeats met elkaar recombineren, zal de intron-spacer in de
expressiekloon diens originele oriëntatie behouden of een omgekeerde (“geflipte”) oriëntatie
bekomen. De plasmiden blijven even effectief ongeacht in welke oriëntatie de introns zitten,
dit “intron flippen” is niet meer dan een “cosmetisch ongemak” (Hilson et al., 2004).
Fig. 3.2: Een RNAi-construct voor gene silencing
Fig overgenomen uit: Hilson et al.,2004
42
Deel 3: Materiaal en Methoden

pAgrikola is een binaire vector, het bevat 2
ori’s van replicatie, 1 voor in coli en 1 voor
in agro cellen.

NptI is een kanamycine resistentie gen (voor
selectie in bacteriën).

Bar is een Basta resistentie gen (voor selectie
in planten).
Fig. 3.3: pAgrikola een afgeleide van pHellsgate 12
Fig overgenomen uit: Hilson et al.,2004

Pnos is een plantenpromotor

Ocs ter is een terminator van transcriptie

35S-promotor staat in voor de start van
transcriptie van het hairpin-construct
3.4. Recombinante DNA-technieken
3.4.1.BAC-isolatie
Arabidopsis thaliana bezit 5 chromosomen. Het volledige genoom van de Arabidopsis
thaliana werd in verschillende kleine fragmenten gesplitst, vervolgens werd elk fragment
gekloneerd in een BAC (bacterial artificial chromosome)-kloon. In de BAC-klones zoeken
we onze genen van interesse. Hierna voeren we een ‘polymerase chain reaction’ (PCR) uit en
kloneren we het PCR-produkt in plasmide pDONRTM221.
Materiaal:

Solution I:
10mM
EDTA
pH 8
Geautoclaveerd en bewaard op 4°C

Solution II:
0,2M
NaOH
1%
SDS
Voor elke isolatie vers maken

Solution III: 50ml 7,5M
K-acetaat
23ml
acetaat
127ml
water
43
Deel 3: Materiaal en Methoden
Praktische uitvoering:
 Neem met een steriel staafje een kolonie van het petriplaatje met BAC-clones en drop
deze in een 500 ml steriele fles met 100 ml TB (Terrific Broth)-medium en
antibioticum.
 Incubeer 12 tot 18 uren lang bij 37°C en 325 rpm.
 Breng de cultuur over in 250 ml centrifuge-flessen en centrifugeer voor 15 min lang
bij 4000 tpm (4°C).
 De pellets worden geresuspendeerd in 4 ml van solution I.
 Mengen en 5 minuten laten staan bij kamertemperatuur.
 Voeg 8 ml solution II toe, meng zachtjes (3 à 4 keer omkeren) laten staan voor 5-10
min bij kamertemperatuur.
 Voeg 6 ml koude solution III toe, meng zachtjes (3 à 4 keer omkeren) en op ijs
plaatsen voor 5-10 min.
 Centrifugeer 15 min lang bij 12.000 tpm, verwijder supernatans en filter doorheen
“miracloth”.
 Voeg 9 ml isopropanol toe aan het supernatans en meng. Centrifugeer 15 min lang bij
9000 tpm.
 Giet het supernatans weg en voeg 1,8 ml TE (10mM Tris pH 8 , 50mM EDTA) om de
pellet op te lossen. Voeg 0,9 ml 7,5M K-acetaat toe en breng over naar een 50 ml
Falcon-tube. Koelen op –70°C gedurende 30 min (of een uur).
 Ontdooi en centrifugeer 10 min lang bij 7900 tpm. Voeg supernatans bij 27 ml van
100% ethanol.
 Centrifugeer 10 min lang bij 7900 tpm, daarna het precipitaat heroplossen in 0,14 ml
50T / 50E. Voeg 10 l RNAse (10mg/ml), transfereer naar een mircrofuge-tube en zet
voor 10 minuten bij 37°C.
 Fenolextractie: Hierbij wordt het RNAse verwijderd. De extractie gebeurt steeds in de
trekkast en handschoenen verplicht gebruiken.
44
Deel 3: Materiaal en Methoden
3.4.2. Fenolextractie
Benodigdheden:
 T10E1
 Fenol ( steeds bij 4 graden Celsius bewaren en juist voor gebruik uithalen)
 Chloroform / IAA (isoamylalcohol, 24:1 verhouding, bewaren bij KT)
Praktische uitvoering:
De epjes bevatten DNA. Het is de bedoeling via een fenolextractie het DNA zeer zuiver te
maken; de enzymen, de zouten,… moeten verwijderd worden. Na de fenolisatie bevinden de
eiwitten zich in de fenolfase en het DNA in de waterfase.
1. Het volume van het staal vermeerderen door er T10E1 aan toe te voegen;
fenolextractie op een klein volume lukt niet goed (toch wordt het staal niet verdund
omdat er later opnieuw geprecipiteerd wordt)  finaal 300 l
2. 300 l fenol toevoegen aan het staal
3. Dekseltjes goed sluiten en gedurende 1 min vortexen
4. 5 min centrifugeren bij 14.000 rpm
5. Bovenste waterige fase overbrengen naar een nieuw epje
6. een gelijk volume chloroform / IAA toevoegen
7. 20 sec vortexen
8. 5 min centrifugeren bij 14.000 rpm
9. Bovenste waterige fase overbrengen naar een nieuwe epje, op het einde vormt de
waterige fase een bel en daarin moet je verder pipetteren
10. Voeg 1 g tRNA toe om een groter precipitaat te bekomen
11. DNA concentreren d.m.v. precipitatie (we willen ook de buffer kwijt waarin de
restrictiedigest gebeurt is)
 DNA volume meten (meestal rond de 270 l, zoeken met pipettor en dan
nog eens controleren)
 1 / 10 volume 5 M natriumperchloraat (5 M NaClO4) en 1 volume
isopropanol toevoegen. Isopropanol loopt snel uit het tipje, dus best eerste keer
opnieuw uitblazen en dan snel pipetteren.
45
Deel 3: Materiaal en Methoden
12. Dekseltje goed sluiten, staal goed mengen (niet vortexen) en 15 min centrifugeren bij
14.000 rpm (het DNA gaat precipiteren)
13. DNA zit in de pellet (supernatans afnemen)
14. Pellet wassen met 200 l 70% ethanol (gewoon toevoegen, niet schudden)
15. 5 min centrifugeren bij 14.000 rpm
16. Ethanol afhalen
17. Pellet laten drogen aan de lucht gedurende 10 min of 37 graden Celsius in
eppendorfincubator gedurende 5 min. Goed nakijken of de pellet goed droog is!
18. DNA resuspenderen in 10-20 l MQ H2O door op en neer pipetteren of door in de
eppendorfincubator te laten schudden (800 rpm)
19. Het DNA is klaar voor gebruik, bewaren bij – 20graden Celsius
20. DNA schatting m.b.v agarosegel of met Nanodrop bij 260 nm.
3.4.3. Plasmidebereidingen
3.4.3.1. Nucleobond DNA zuivering (midi)
Bevinden zich in de Nucleobond kit:
S1-buffer
100 g / mL
RnaseA (zelf toevoegen)
50 mM
Tris / HCl
10 mM
EDTA
pH 8.0
S2-buffer
S3-buffer
200 mM
NaOH
1%
SDS
2.8 M
Kac
pH 5.1
N2-buffer
100 mM
Tris
900 mM
KCl
15 %
Ethanol
0.15 %
Triton® X-100
gebracht op pH 6.3 met H3PO4
N3-buffer
100 mM
Tris
1.15 M
KCl
15 %
Ethanol
46
Deel 3: Materiaal en Methoden
gebracht op pH 6.3 met H3PO4
N5-buffer
1M
KCl
100 mM
Tris
15 %
Ethanol
gebracht op pH 8.5 met H3PO4
Praktische uitvoering: (Nucleobond Midi AX100 voor 'high-copy' plasmiden)
 Zet een cultuur in door E.Coli cellen te enten op 30mL LB+ medium met kanamycine
 Incubeer overnacht bij 37 o C
 Oogst de cellen door centrifugeren, 5 à 10 min bij 3800 tpm
 Resuspendeer de bacteriële pellet in 4 mL S1-buffer (bevat Rnase)
 Voeg 4 mL S2-Buffer toe: NaOH (verbreekt H-bruggen van dsDNA, hierdoor slaat
het DNA neer) en SDS (bindt en ontvouwt eiwitten, waardoor deze neerslaan) gaan de
celmembranen openbreken
 Voeg 4 mL S3-Buffer toe: deze bevat azijnzuur, waardoor de pH daalt
en het
plasmide DNA wordt opgelost (de H-bruggen worden hersteld), maar het genomisch
DNA blijft neergeslagen, het is te groot om weer dubbelstrengig te worden.
 Zet de falcon voor 5 min op ijs
 Voeg 2,5 ml N2-Buffer toe aan de Nucleobond-kolom voor equilibratie
(voorbereidende stap).
 Bevochtig een Nucleobond gevouwen filter met 2 ml N2-buffer
 Breng het lysaat hierop, deze filtratiestap verwijderd SDS en cellulaire afval
 Breng nu het gefilterde lysaat op de kolom
 Was de kolom met het opgevangen lysaat met 10 ml N3-buffer
 De elutie gebeurt in een nieuwe falcon met 5 ml N5-buffer
 Voeg in de falcon 3,5 ml isopropanol (bij kamertemperatuur) toe om het plasmide
DNA te precipiteren. Goed mengen.
 Centrifugeer 40 min met 7900 tpm bij 4°C (SLA 1500)
 Het supernatans voorzichtig weggieten.
 Voeg 2 ml 70% ethanol toe om isopropanol en residuele zouten te verwijderen
 Centrifugeer 15 min met 7900 tpm bij 4°C
47
Deel 3: Materiaal en Methoden
 Supernatans voorzichtig weggieten en DNA pellet aan de lucht laten drogen door de
falcon omgekeerd op een stuk papier te plaatsen.
 Voeg hierna 100 l water toe.
3.4.3.2. Promega DNA zuivering op kleine schaal (mini)
Bevinden zich in de “Wizard Plus SV Minipreps DNA Purification System” kit:
Lysebuffer
0.2 M NaOH
1% SDS
Resuspensiebuffer
50 mM Tris-HCl (pH 7.5)
10 mM EDTA
100 µg / ml Rnase A (zelf toevoegen)
Neutralisatiebuffer
4.09 M guanidine hydrochloride
0.759 M Kaliumacetaat
2.12 M ‘glacial’ acetaat
Final pH is approximately 4.2.
Wasbuffer
162.8 mM kaliumacetaat
22.6 mM Tris-HCl (pH 7.5)
0.109 mM EDTA (pH 8.0)
Voeg 170 ml ethanol toe voor de 250-prep systeem
De eindconcentraties zullen ongeveer 60% ethanol, 60 mM
kaliumacetaat, 8.3 mM Tris-HCl en 0.04 mM EDTA zijn.
48
Deel 3: Materiaal en Methoden
Praktische uitvoering:
Vorming van geklaarde lysaat
 Oogst de cellen door 1-10ml van een overnacht cultuur 5 min lang te centrifugeren bij
14.000 rpm. Verwijder supernatans.

Voeg 250 l Cel Resuspensie buffer toen aan de celpellet. Pipeteer op en neer, totdat
alles geresuspendeerd is.

Voeg 250 l cellyse buffer toe aan elke staal en 4 maal omkeren om te mengen.

Voeg 350 l neutralisatie buffer toe en 4 maal omkeren om te mengen.

Centrifugeer 10 min lang bij 14.000 rpm.
Binding van plasmide DNA
 Insereer een centrifuge kolommetje in een tube

Giet het lysaat in het kolommetje

Centrifugeer 1 min lang bij 14.000 rpm. De ‘flow through’ mag weggegoten worden.
Kolom op een tube brengen.
Wassen
 Wassen met 750 l wasbuffer (ethanol werd zelf toegevoegd).

Centrifugeer 1 min lang bij 14.000 rpm.

Herhaal de wasstap, maar deze keer met 250 l wasbuffer.

Centrifugeer 2 min lang bij 14.000 rpm.
Elutie
 Breng de centrifuge kolom over naar een steriele 1,5 ml microcentrifuge tube

Voeg 100 l nuclease vrij water toe aan de kolom

Centrifugeer 1 min lang bij 14.000 rpm

Bewaar DNA op –20 C
49
Deel 3: Materiaal en Methoden
3.4.3.3. Roche DNA-zuivering op kleine schaal (mini)
Dit protocol geeft zuiverder DNA dan dat van Promega. Er blijven geen proteasen meer
achter die zouden kunnen interferen met het LR-clonase in de LR-reactie bijvoorbeeld.
Bevinden zich in het Roche High pure plasmid isolation kit:
Suspensiebuffer
25 ml (80 ml)
50 mM Tris-HCl en 10 mM EDTA,
pH 8.0 (25° C)
Rnase A
2.5 mg (8 mg)
droog poeder dat moet opgelost worden in Suspensie Buffer
Lyse buffer
25 ml (80 ml)
0.2 M NaOH en 1% SDS
Bindingsbuffer
25 ml (80 ml)
4 M guanidine hydrochloride en
0.5 M kalium acetaat, pH 4.2
Wasbuffer II
10 ml (50 ml); voeg 40 ml (200 ml) absoluut ethanol toe
20 mM NaCl, 2 mM Tris-HCl, pH 7.5 (25°C) (eindconcentratie na
toevoeging van ethanol)
Voor stammen met lage nuclease activiteit
Elutie buffer
40 ml 10 mM Tris-HCl,
pH 8,5 (25C)
50
Deel 3: Materiaal en Methoden
Praktische uitvoering:

Zet de bindingsbuffer op ijs (of in de koelkast).

Centrifugeer de bacteriele cellen 30 sec bij 14.000 rpm. Verwijder supernatans.

Voeg 250 l suspensiebuffer (met RNase) aan de stalen.

Resuspendeer de bacteriele pellet en meng goed.

Voeg 250 l lysebuffer toe

Meng zachtjes door de epjes 3 tot 6 maal om te keren.

Incubeer 5 min bij kamertemperatuur.

Voeg 350 l gekoelde bindingsbuffer toe

Meng zachtjes door de epjes 3 tot 6 maal om te keren.

Incubeer 5 min op ijs.

Centrifugeer 10 min bij 14.000 rpm.

Na centrifugatie, insereer je een “high pure filter tube” in een “collection-tube”

Transfereer het supernatans naar het bovenste reservoir van de filtertube

Centrifugeer 1 min bij 14.000 rpm.

Na centrifugatie neem je de filtertube uit de collectietube, verwijder je de flowthrough
en steek je de filtertube terug in collectietube.

Voeg 700 l wasbuffer II toe aan het bovenste reservoir van de filtertube

Centrifugeer 30 tot 60 s bij 14.000 rpm en verwijder daarna de flowthrough.

Centrifugeer nog eens 1 min bij 14.000 rpm, zodat overblijvende wasbuffer wordt
verwijderd.

Verwijder de collectietube.

Steek de filter tube in een nieuwe epje.

Voeg 100 l elutiebuffer of MilliQ water (dit is aan te raden wanneer je gaat
transformeren met behulp van elektroporatie, de elutiebuffer bevat zouten die kunnen
leiden tot kortsluiting) toe aan de bovenste reservoir van de filtertube.

Centrifugeer 1 min lang bij 14.000 rpm.

Bewaar DNA bij -20C.
51
Deel 3: Materiaal en Methoden
3.4.4. PCR
De Polymerase Chain Reaction (PCR) wordt gebruikt om in vitro een bepaalde DNAfragment te amplificeren door de omstandigheden van in vivo DNA-replicatie na te bootsen.
De techniek berust op de hybridisatie van twee enkelstrengige primers tegen complementaire
plaatsen van het gedenatureerde doel-DNA. Met behulp van een enzymatische reactie waarbij
gebruik wordt gemaakt van een DNA-polymerase, wordt het tussenliggende DNA gevormd.
Voor deze reactie zijn een aantal componenten noodzakelijk, namelijk een enkelstrengige
DNA-template, primers (oligonucleotiden waarvan de sequenties complementair zijn met de
uiteinden van een bepaalde sequentie van de DNA-template), deoxynucleotide trifosfaten
(dNTP’s) en een DNA polymerase enzyme (Figuur 3.4). Enkelstrengig DNA kan verkregen
worden door dubbelstrengig DNA te verhitten en zo de beide strengen uit elkaar te smelten.
De meeste reactiebuffers bevatten al Mg2+, maar voor sommige buffers moet dit nog aan de
reactiemix toegevoegd worden. De meeste polymerasen die gebruikt worden bij PRC-reacties
zijn hittestabiel.
De polymerase kettingreactie zelf bestaat uit drie thermale stappen: denaturatie, ‘annealing’
en elongatie. Het geheel van deze drie stappen vormt een cyclus, die meermaals herhaald
wordt ter amplificatie van de beoogde DNA-sequentie (Figuur 3.4).
Tijdens de eerste stap, de denaturatiestap, wordt de temperatuur tot 92-96°C gebracht om de
dubbelstrengige DNA-streng te denatureren. DMSO wordt eventueel toegevoegd om het
DNA te helpen denatureren. Het is voldoende om de DNA-mix gedurende 3 tot 5 minuten te
verhitten tot 95°C om volledig het genomisch DNA te denatureren. Ook de activatie van
sommige polymerase enzymen gebeurt tijdens deze eerste stap. ‘Hot Goldstar’, bijvoorbeeld,
moet gedurende 10 minuten geactiveerd worden bij 95°C. De denaturatiefase is ook nodig om
de secundaire en tertiaire producten (zie verder) van hun template te verwijderen zodat de
polymerisatie reactie kan blijven doorgaan met een exponentieel stijgend aantal templates.
Bij de tweede stap, de ‘annealing’, wordt de reactiemix op een temperatuur gebracht van 4572°C om de primers te laten binden aan de complementaire sequentie van de DNA-template.
De belangrijkste keuze tijdens het opstellen van een PCR programma is die van de “annealing
temperatuur”, de temperatuur waarbij de primers zich aan de templaat zullen hechten. Tijdens
de eerste vijf cycli moeten de primers eerst de templaat screenen vooraleer de complementaire
sequentie gevonden wordt. Hierbij is de temperatuur van groot belang. Indien de temperatuur
bij aanhechting te hoog is zal geen “annealing” plaatsvinden. Indien de temperatuur te laag is,
zullen de primers hybridiseren met eender welke genomische site met gedeeltelijke
52
Deel 3: Materiaal en Methoden
complementariteit. De “annealing” temperatuur kan berekend worden met volgende
empirische formule:
Tm = 4x (G+C) + 2x (A+T)
De optimale ‘annealing’ temperatuur kan echter tot 12°C boven of onder de berekende
waarde liggen. Daarom wordt deze stap meestal bij een bepaalde ‘range’ rond de berekende
waarde uitgevoerd.
De elongatiestap is het opnieuw laten stijgen van de temperatuur tot 72 °C of 68 °C,
afhankelijk van het gebruikte polymerase, zodat de eigenlijke polymerisatie ter hoogte van de
3’OH-eindjes van de primers kan plaatsvinden door toevoeging van dNTP’s. Normaal gezien
zijn 20 seconden bij 72°C voldoende om een fragment korter dan 50 bp, en 40 seconden voor
fragmenten tot 1,2 kb, te verlengen. Standaard wordt gerekend dat het 1 minuut duurt om
1000 basenparen toe te voegen.
Wanneer twee verschillende primers, die elk selectief binden met een van de complementaire
strengen, toegevoegd worden, dan zal bij de tweede cyclus, de nieuw gevormde DNA-streng
ook een templaat vormen voor de andere primer. Op deze manier zal elke nieuwe cyclus het
aantal templaten stijgen en zal de synthese van DNA-fragmenten via amplificatie dus
exponentieel stijgen.
De theoretische exponentiële synthese van een DNA-fragment (N) kan dan berekend worden
met volgende formule:
N= (2n – 2n)x
waarbij :
n = het aantal cycli
2n = de primaire en secundaire extensieproducten met onbepaalde lengte
x = het aantal kopieën van de oorspronkelijke templaat
De primaire extensieproducten ontstaan na de eerste cyclus wanneer de originele DNAtemplate afgeschreven wordt. Secundaire extensieproducten ontstaan door DNA-synthese, na
denaturatie van de primaire producten, welke lineair geamplificeerd worden in de volgende
cycli. Deze secundaire structuren zijn van onbepaalde lengte.
Tijdens de derde cyclus worden de eerste “target” fragmenten van welbepaalde lengte
gevormd, door de secundaire producten als template te gebruiken. De lengte en genomische
positie van deze fragmenten wordt dus bepaald door de primersequenties.
53
Deel 3: Materiaal en Methoden
Na de eerste vier cyclussen (Figuur 3.4) vindt een exponentiële amplificatie van deze “target”
fragmenten plaats.
Fig. 3.4.: PCR-principe
De mix nodig voor de polymerisatie reactie bevat de volgende componenten:

x µl DNA (1 ng / 100 µl) (bij kolonie PCR : enkele cellen toevoegen met een
tandenstoker, deze bevatten het template DNA)

1 µl primer forward (stock = 10 µM, finaal = 0,2 µL)

1 µl primer reverse (stock = 10 µM, finaal = 0,2 µL)

2.5 µl DMSO (5% finaal) (eventueel)

DNA polymerase (0,8-1 U / 100 µl)

5 µl reactiebuffer (10x)

2 µl MgCl2 (50 mM) (indien nodig)

1 µl dNTP’s (10 mM)

x µl H2O
Totaal : 50 µl mix
54
Deel 3: Materiaal en Methoden
Het PCR-toestel wordt zodanig ingesteld dat een bepaald programma gevolgd wordt, waarbij
enkele stappen, de thermale cyclus, een aantal keer herhaald wordt.
Programma :
1. x min 95°C
2. x min 95°C

stap 2 tot 4
3. x min Tm +/- 12°C

35 x herhalen
4. x min 68 °C

5. 10 min 68 °C
6. ∞ 4°C
De thermale cyclus mag niet meer dan 40 maal herhaald worden. Bij een groter aantal cycli
zou de kans op ongewenste geamplificeerde producten stijgen
3.4.5. Restrictiedigesten
Restrictie-enzymen zijn endonucleasen die zich van algemene DNasen onderscheiden doordat
ze een bepaalde sequentie herkennen en bijgevolg slechts het DNA verknippen waarin deze
sequentie voorkomt. Verknippen van een DNA-molecule met restrictie-enzymen geeft steeds
aanleiding tot het ontstaan van een 3’-hydroxyleinde en een 5’-fosfaateinde. Een aantal
enzymen knipt midden in de symmetrische herkenningssequentie (palindroom sequentie) en
geven ontstaan aan stompe eindjes. Andere enzymen knippen niet middenin maar toch
symmetrisch tegenover een denkbeeldig symmetriepunt, zodat ofwel 5’- of 3’-overhangende
uiteinden ontstaan.
Restrictie-enzymen beschermen bacteriën tegen infecties van virussen, ze vernietigen
namelijk
vreemde
DNA
moleculen.
Restrictie-enzymen
fungeren
als
microbiële
immuunsystemen.
Restrictie-enzymen komen meestal voor in combinatie met 1 of 2 modificatie enzymen,
DNA-methyltransferasen, dat het endogeen DNA beschermt tegen klieving door de eigen
restrictie-enzymen. Modificatie-enzymen herkennen dezelfde DNA-sequenties als het
restrictie-enzym dat ze begeleiden, maar in plaats van de sequentie te klieven, gaan ze 1 van
de bases methyleren in elk van de DNA-strengen. De methyl groepen dringen de grote DNA
groeve binnen ter hoogte van de bindingssite en verhinderen zo de interactie met het
restrictie-enzym.
55
Deel 3: Materiaal en Methoden
Restrictie-enzymen worden onder andere gebruikt om te controleren of DNA-fragmenten in
een vector werden opgenomen en of een restrictieplaats-creërende mutatie werd aangebracht.
Om de reactie te stoppen kunnen de enzymen geïnactiveerd worden door middel van hitte,
fenolisatie of door toevoegen van inhiberende reagentia zoals EDTA of glycerol.
Samenstelling van het restrictie-enzym digest
Een bepaalde hoeveelheid gezuiverd DNA (afhankelijk van de concentratie) wordt
gedigereerd met 1 à 2 Units (U, waarbij 1 U overeenkomt met de hoeveelheid enzym nodig
om 1 µg DNA te knippen in 1 uur tijd, bij een geschikte temperatuur, in een gegeven
eindvolume van 20 of 50 µl in een geschikte buffer) restrictie-enzym in een gepaste 1x
reactiebuffer. Voor samengestelde digesten met 2 restrictie-enzymen wordt de buffer
aangepast voor de optimale werking van beide enzymen.
De enzymen die gebruikt werden in dit thesiswerk zijn vooral afkomstig van New England
Biolabs. De digestiemix wordt gedurende 2 uur tot overnacht geïncubeerd bij 37°C in een
Thermoblok.
De mix nodig voor de restrictiedigest bevat de volgende componenten:

x µl DNA (100ng-1000ng)

2 µl Buffer (10x)

2 µl BSA (10x) (indien nodig)

x µl restrictie enzyme A

x µl restrictie enzyme B (eventueel)

x µl H2O
Totaal : 20 µl mix
56
Deel 3: Materiaal en Methoden
3.4.6. Ligatie
Praktische uitvoering
DNA-fragmenten kunnen enzymatisch aan elkaar geligeerd worden, bijvoorbeeld met T4
DNA-ligase bij de ligatie van een DNA-fragment in een opengeknipte vector, wanneer de aan
elkaar te ligeren eindjes compatibel zijn.
Voor het bepalen van de hoeveelheid insert, wordt volgende berekening toegepast
# nucleotiden vector / # nucleotiden insert = a ng vector / b ng insert
Waarbij 3 x a de hoeveelheid benodigde insert in ng is.
De mix nodig voor de uitgevoerde ligatie bevatte de volgende componenten:

1 µl 50 ng pKNTAP (vector gebruikt voor N-TAP, opgeknipt met AscI en PacI)

1 µl PCR fragment (digestie ondergaan met AscI en PacI)

5 µl T4 Ligase buffer (5 x)

2,5 µl T4 Ligase

15,5 µl H2O
Totaal : 25 µl mix
Voeg alle componenten samen en incubeer overnacht bij 16°C of een uur bij
kamertemperatuur.
57
Deel 3: Materiaal en Methoden
3.4.7. Gateway™ Klonering
Gateway™ is een universele kloneringstechnologie gebaseerd op het bacteriofaag  sitespecifieke recombinatie systeem (Landy 1989; Ptashne 1992) dat zorgt voor een snelle en
zeer efficiënte manier om heterologe DNA sequenties te transfereren naar een multiple
vector-systeem voor functionele analyse en proteïne-expressie.
Twee recombinatie-reacties vormen de basis van de Gateway-technologie : de BP-reactie en
LR-reactie.
In lambda recombinatie-reacties gebeurt de recombinatie-reactie tussen faag lambda en het E.
coli chromosoom via specifieke recombinatie (“att” attachment sites) en wordt gekatalyseerd
door een mix van recombinatie proteïnen (clonaseTM enzyme mix).
Voor de lysogene padweg hebben we de reactie attB x attP  attL x attR gekatalyseerd door
BP-clonaseTM (Int, IHF).
Voor de lytische padweg hebben we de reactie attL x attR  attB x attP gekatalyseerd door
LR-clonaseTM (Int, Xis, IHF).
3.4.7.1. De BP- recombinatie reactie
De BP-recombinatie reactie (Figuur 3.5) vergemakkelijkt de recombinatie van een attBsubstraat (e.g. attB PCR-product of expressiekloon) met een attP-substraat (donor-vector,
hierbij wordt er een attL-bevattende entrykloon gevormd. Deze reactie wordt gekatalyseerd
door de BP-clonaseTM enzyme-mix, een mengeling van het  Integrase (Int) en de E. coli
Integration Host Factor (IHF) proteïnen.
Fig. 3.5: De BP recombinatie reactie
58
Deel 3: Materiaal en Methoden
Benodigdheden: -
Vector: pDONRTM221
-
BP clonaseTM enzyme mix (bewaren op – 80°C)
-
5X BP-clonaseTM reactiebuffer
-
ProteïnaseK oplossing (bewaren op – 80°C): 2 g / l in 10mM Tris
HCl, pH 7,5; 20 mM CaCl2 en 50% Glycerol.
Werkwijze:
1. Voor elke BP-recombinatie reactie worden volgende componenten in een 1,5 ml
eppendorf gedaan bij kamertemperatuur en gemengd:
-
100 fmol donorvector
-
100 fmol attB bevattend PCR-product
-
4 l BP-buffer
-
x l water
Leng aan tot 16 l
2. Verwijder BP-clonaseTM enzyme mix uit de –80°C diepvries en ontdooi op ijs voor 2
min. Men kan ook 4 l BP-clonase II gebruiken (dit is clonase met buffer samen). Het
is belangrijk om een equimolaire hoeveelheid van attB PCR-produkt en donor-vector
toe te voegen.
3. Vortex 2 maal 2 sec de BP-clonaseTM enzyme mix.
4. Voeg bij elke staal 4 l BP clonaseTM enzyme mix. Goed mengen door 2 maal 2 sec
kort te vortexen.
5. Incubeer de reacties 3 à 4 uur bij 25°C. Afhankelijk van de behoefte kan de duur van
de recombinatie reactie verlengd worden tot 18 uur (vooral geschikt voor grote
inserts).
6. Voeg 2 l proteïnase K oplossing toe aan elke sample en incubeer 10 min bij 37°C.
Dit is nodig om het BP clonase af te breken en aspecifieke recombinatie met het E.
coli genoom te voorkomen.
7. Transformeer 5 µL naar 50 µL competent E. coli (e.g. DH5) via heat shock en voeg
950 µL SOC toe, zet 1 uur in shaker bij 37°C en plaat dan de hele reactie uit op LB +
Km 50 µg/mL.
59
Deel 3: Materiaal en Methoden
3.4.7.2. De LR-recombinatie reactie
De LR-recombinatie reactie (Figuur 3.6) vergemakkelijkt de recombinatie van een attL
bevattende entry-kloon met een attR bevattende destination vector. Deze reactie wordt
gekatalyseerd door LR-clonaseTM enzyme mix, een mengsel van de  Int en Excionase (Xis)
proteïnen en de E.coli IHF proteïnen.
Fig. 3.6: De LR recombinatie
reactie
Benodigdheden: -
Destination vectoren: pAgrikola, pKNTAP, pKCTAP
-
Entryvectoren
-
LR clonaseTM enzyme mix (bewaren op – 80°C) (plus voor multisite)
-
5X LR clonaseTM reactie-buffer (plus voor multisite)
-
Proteïnase K oplossing (bewaren op – 80°C): 2 g / l in: 10 mM Tris
Hcl, pH 7,5; 20 mM CaCl2 , 50% Glycerol.
Werkwijze:
1. Voor elke LR-recombinatie reactie worden volgende componenten in een 1,5 ml
eppendorf gedaan bij kamertemperatuur en gemengd:
 Gewone LR: bvb pAgrikola x pEntryL1L2-3’ UTR
-
1 l pAgrikola (75 ng / l)
-
2 l pEntry L1L2 antisense 3’ UTR
-
1 l LR clonase buffer
-
1 l LR clonase
____
5 l
60
Deel 3: Materiaal en Methoden
 Multisite LR: CTAP
-
20-25 fmol attL4 and attR1 entry-vector (met promoter)
20-25 fmol attL1 and attL2 entry-vector (met ORF)
20-25 fmol attR2 and attL3 entry-vector (met TAP-tag)
20-25 fmol destination vector (pKCTAP)
Zorg ervoor equimolaire hoeveelheden DNA te gebruiken
-
4 l 5x LR clonase plus buffer
-
x l water
Werk in een totale concentratie van 20 l.
 Multisite LR: NTAP
-
1 l 150 ng pKNTAP
1 l 50 ng pEntryL4L3-P35S
1 l 50 ng pEntryL1L2-ORF (met stop)
-
4 l 5x LR clonase plus buffer
-
x l water
Werk in een totale concentratie van 20 l.
2. Verwijder het LR-clonase (plus) enzyme uit de –80°C diepvries en ontdooi op ijs
voor 2 min.
3. Vortex 2 maal 2 sec de LR-clonase (plus) enzyme mix.
4. Voeg nu bij elk staal de LR-clonase (plus) enzyme mix. Goed mengen door 2 maal
2 sec kort te vortexen.
5. Incubeer de reacties 16 uur bij 25°C.
6. Voeg 2 l proteïnase K oplossing toe aan elke sample en incubeer 10 min bij
37°C.
7. Transformeer 5 µL naar 50 µL competent E. coli (e.g. DH5) via heat shock en
voeg 950 µL SOC, zet 1 uur in shaker bij 37°C en plaat dan de hele reactie uit op
selectieve media.
61
Deel 3: Materiaal en Methoden
3.4.8. Agarose Gelelektroforese
Om DNA te analyseren, bijvoorbeeld bij concentratiebepaling, bij preparatieve zuiveringen,
voor het bekijken van een restrictiepatroon, bij controleren van een gevormd PCR-produkt,
gebruiken we agarose gelelektroforese. Op een agarosegel kunnen DNA-fragmenten
gescheiden worden volgens grootte en lading. Hierbij is de afgelegde weg omgekeerd
evenredig met de logaritme van het aantal baseparen en is afhankelijk van de concentratie van
de gebruikte agarosegel.
Agarose is een lineair suikerpolymeer dat wordt aangekocht in poedervorm.
Gebruikte oplossingen:
10x ladingsbuffer
0.25% broomfenolblauw
50%
glycerol
2%
0.5 M Na2EDTA
0.25% xyleencyanol
10x TAE (5L)
242 g Tris
57.1 mL glacial acetaat
100 mL 0.5 M EDTA
pH 8.0
SmartLadder
Agarose: 1,2% agarose in 0,5x TAE
62
Deel 3: Materiaal en Methoden
Werkwijze:
Het poeder wordt in een 1,2% (w/v) concentratie opgelost in 0.5 x TAE-buffer en gesmolten
door op te koken in de microgolfoven. Achteraf wordt het bewaard in een warmwaterbad bij
60oC.
Bij gebruik wordt de vloeibare, hete agarose in een bakje gegoten en een kammetje wordt in
de vloeistof geplaatst om slotjes te vormen waar later het staal ingebracht zal worden.
Na 30 minuten afkoelen vormt het gestolde agarose een gel.
We plaatsen de gel in een bad, gevuld met elektroforesebuffer (0.5 x TAE), waarover we een
elektrisch veld kunnen aanleggen.
Het staal wordt vermengd met 10X ladingsbuffer en in de slotjes gebracht.
DNA is bij neutrale pH negatief geladen en zal dus wanneer het in een elektrisch veld (100 V)
komt migreren naar de positieve pool. De scheiding over het gel gebeurt volgens de lengte
van de verschillende fragmenten, aanwezig in het staal. Doordat naast de stalen ook een
standaard lengtemerker (Smart ladder, Eurogentec) geladen wordt, kunnen we de grootte
bepalen van de verschillende fragmenten.
Na de elektroforese wordt de gel voor een kwartier
in een badje met 0.007%
ethidiumbromide (zeer carcinogeen!!) gelegd, dit dient voor visualisatie van het DNA onder
UV-licht. Het ethidiumbromide gaat intercaleren tussen de GC-baseparen van het DNA.
Wanneer de gel onder UV-licht gehouden wordt, licht het ethidiumbromide op met een
intensiteit die afhankelijk is van de hoeveelheid DNA in het staal en kunnen we een foto
nemen. Aan de hand van de standaard lengtemerker en de totale hoeveelheid ingebracht staal
kunnen we afleiden hoeveel ng / µl DNA zich ongeveer in het staal bevindt, aangezien de
merker immers een geijkte hoeveelheid van elk lengtefragment bevat.
63
Deel 3: Materiaal en Methoden
3.5. Transformatie
Bij transformatie is het de bedoeling vreemd DNA in een gastheercel binnen te brengen,
bijvoorbeeld een plasmide met daarop een antibioticum-resistentiegen en het gen van
interesse.
De aanwezigheid van het resistentiegen laat toe op een eenvoudige manier en binnen een
korte periode enkel die cellen te selecteren, die het betreffende plasmide bevatten. De andere
cellen zullen immers afsterven aangezien zij het resistentiegen niet bezitten.
Transformatie naar competente bacteriële cellen kan op meerdere manieren gebeuren, zoals
elektroporatie en hitte schok transformatie.
Vooraleer we DNA kunnen transformeren naar bacteriën moeten de cellen competent
gemaakt worden. Competente cellen zijn cellen waarvan de celwand en het cytoplasmatische
membraan voorbehandeld zijn, zodat ze in staat zijn plasmiden langs deze weg op te nemen.
3.5.1. Transformatie van competente E. coli cellen
Hitte schok (heatshock) transformatie
Een veel gebruikte methode voor het maken van competente E. coli cellen is een
voorafgaandelijk behandeling met calciumionen. Men vermoedt dat de calciumionen de
negatieve ladingen van de fosfolipiden in het celmembraan neutraliseren, waardoor het DNA
gemakkelijker doorheen de celwand kan. De cellen worden bij deze methode ook altijd
onderworpen aan een hitteschok (‘heat shock’), deze stap is cruciaal voor een efficiënte DNA
opname door de cellen.
 Zet de benodigde hoeveelheid epjes op ijs, zodat ze al kunnen koelen
 100 l competente E. coli cellen (DH5 - of DB3.1 stam werden gebruikt) worden
ontdooid op ijs.
 De gekoelde epjes vullen met 50 l competente E. coli cellen
 Hierbij doe je 5 l van het te transformeren DNA
 Schudden door lichtjes te tikken op het epje
 Let op: dit alles gebeurt op ijs
 Hou het mengsel 5 à 20 min op ijs
 In thermoblok voor 42 sec bij 42°C plaatsen
 Daarna 2 min op ijs
64
Deel 3: Materiaal en Methoden
 Voeg 950 l SOC medium toe
 Breng dit mengsel over naar een 12 ml falcon
 Zet dit alles 1 uur lang in de shaker bij 37°C
 Centrifugeer 10 min lang 3800 rpm
 Giet het supernatans weg
 Los de celpellet op in 100 l SOC medium
 Plaat alles uit op selectief medium (LB+ met antibioticum)
 Voeg glaspareltjes toe en schud zodat alles gelijkmatig verspreid wordt
 Zet overnacht in een oventje bij 37°C of over weekend bij KT
Transformatie via elektroporatie
Bij elektrotransformatie wordt het plasmide in de cellen binnengebracht door een korte
elektrische schok toe te dienen. Door de krachtige elektrische puls worden immers gaten
geslagen in het celmembraan waardoorheen DNA naar binnen dringt.

Breng ongeveer 100 ng DNA in een ijskoud elektroporatiecuvet.

Voeg 40 μl op ijs ontdooide competente cellen toe en bewaar de cuvetten steeds op ijs.

Elektroporeer in een elektroporatiekamer bij 200 Ω, 25 μF en 2.5 V tot het toestel een
signaal geeft.

Voeg onmiddellijk 1 ml SOC medium aan de cellen om zoveel mogelijk
transformanten in leven te houden.

Incubeer 1 uur bij 250 rpm en 37 °C.

Plaat 100 μl uit op LB medium met het juiste selectie-antibiotica.

Incubeer overnacht bij 37°C.
65
Deel 3: Materiaal en Methoden
3.5.2. Transformatie van competente Agrobacterium tumefacians cellen
 Bereid 50ml YEB met antibioticum
 Inoculeer met Agrobacterium tumefacians
 Groei 24 uur lang bij 28°C
 Centrifugeer 2min bij 14.000 rpm
 Was de pellet 4 maal met MilliQ water (50ml, 25ml, 12,5ml; 5ml)
 Hou de cellen op ijs (max 1 uur)
 Elektroporatie:
-
Voeg 1 g plasmide DNA aan 200 l bacteriën, zet 1 min op ijs
-
Breng 200 l DNA/bacterie mix in een gekoelde elektroporatie cuvet, eventjes
tikken op de bench om luchtbellen te vermijden
-
Na elektroporatie voeg je 800 l YEB toe en transfereer naar een eppendorf
-
Incubeer 2 uur lang bij 28°C op de shaker
-
Plaat verschillende concentraties bacteriën uit: 20, 50 -en 100 l op selectief
medium
-
Plaats dan in de oven bij 28°C of de bench voor enkele dagen
3.5.3. Transformatie van PSB-d Arabidopsis thaliana cellen
De PSB-d cellen werden getransformeerd via co-cultivatie met Agrobacterium tumefaciens.
Agrobacterium tumefaciens is in staat om ‘crown gall’ (tumoren) in planten te veroorzaken.
Het doet dit door een deel van zijn genoom, het T-DNA, te integreren in het plantengenoom
van geïnfecteerde cellen. Dit T-DNA bevindt zich op een plasmide, het Ti-plasmide, en wordt
geflankeerd door een linker en een rechter ‘border’. Op het T-DNA zitten de functies voor het
induceren van tumoren. Dit systeem werd omgevormd, zodat het efficiënt gebruikt kan
worden voor transformatie van plantencellen. Zo zijn de genen, die de tumoren veroorzaken,
uit het T-DNA gehaald en kan men een ander gen in het T-DNA inbrengen. Deze constructen
kunnen dan in Agrobacterium tumefaciens getransformeerd worden, waarna A. tumefaciens
het T-DNA, dat nu het gen van interesse bevat, stabiel kan integreren in het genoom van de
plantencellen (Figuur 3.7). Door op de vector nog een antibioticum resistentiegen te plaatsen,
kunnen de cellen die getransformeerd zijn, geselecteerd worden op medium met het
antibioticum.
66
Deel 3: Materiaal en Methoden
Fig. 3.7: Agrobacterium gemedieerde plant transfomatie
Praktische uitvoering
 We bereiden een 2 ml precultuur met YEB medium (met de benodigde antibiotica) en
A. tumefaciens cellen in een 10 ml falcon. Deze wordt overnacht in een shaker gezet
bij 28°C.
 De volgende dag bereiden we een 20 ml cultuur in een 100 ml erlenmeyer met hierin
ons 2 ml precultuur en 18 ml YEB medium met dezelfde antibiotica die gebruikt
werden voor ons precultuur. Deze wordt overnacht in een shaker gezet bij 28°C.
 De volgende dag wassen we de antibiotica weg uit de 20 ml cultuur.
 We doen de cellen in een 50 ml falcon en centrifugeren 15 min bij 4000 rpm. Achteraf
supernatans weggieten.
 Los de pellet op in 20 ml MSMO dmv vortexen.
 Centrifugeer 15 min bij 4000 rpm. Achteraf supernatans weggieten.
 Los de pellet op in 20 ml MSMO dmv vortexen.
 We bepalen de optische densiteit (OD) bij 600 nm in een spectrofotometer:
1) Vul een cuvet met 1 ml MSMO voor de blancometing
2) Vul een cuvet met 0,5 ml MSMO en 0,5 ml cellen
3) Meten bij OD600nm
4) Berekening van de hoeveelheid MSMO die aan de celpellet moet
67
Deel 3: Materiaal en Methoden
worden toegevoegd om een OD van 1 te krijgen via volgende formule:
Vbegin . Cbegin (x2) = Veind . Ceind met Veind het toe te voegen volume aan
MSMO.
 Centrifugeer 15 min bij 4000 rpm. Achteraf supernatans weggieten.
 We lossen de pellet op in MSMO zodanig dat de OD600nm = 1.
 In een 6-well plaat brengen we 3 ml PSB-D cellen met 200 μl A. tumefaciens cellen en
6 μl acetosyringone (200 M).
 Plaats de plaat 2 dagen lang in een 25°C shaker bij 130 rpm in het donker
 Transformatie via selectie van calli op plaat:
-
Agrobacteria worden eerst weggewassen
-
1 ml uitplaten op MSMO met antibiotica, paar weken laten groeien
-
GFP detectie met Leica MZ16F fluorescentie microscoop
-
Materiaal van de plaat in cultuur brengen in 30 ml MSMO met de agroafdodende antibiotica vancomycine (Vm), carbemicilline (Cb) en het
selectieve antibioticum (AB).
-
Om de week het medium verversen (43 ml MSMO met selectief antibioticum
+ 7 ml celcultuur).
-
Cellen oogsten.
 Rechtstreekse transformatie (alternatief):
-
In een 6-well plaat brengen we 7 ml MSMO (+ Cb, Vm, en selectief AB.)
samen met 3 ml celcultuur.
-
Breng de totale 10 ml uit een well over naar een 25 ml erlenmeyer.
-
Na een week wordt dit dan overgegoten in een 100 ml erlenmeyer met vers
MSMO (+antibiotica) medium (30 ml).
-
Om de week het medium verversen.
-
Cellen oogsten.
68
Deel 3: Materiaal en Methoden
3.6. Eiwittechnieken
Het werken met eiwitten gebeurt steeds op ijs!!!
3.6.1. Eiwitextractie bereiding voor expressie-analyse
Oplossingen
Extractiebuffer = Homogenisatiebuffer (HB)
Eindconc
25mM
15mM
15mM
150mM
15mM
60mM
1mM
0,1%
0,1mM
1mM
1mM
10μg/ml
10μg/ml
10μg/ml
0,1mM
5μg/ml
5μg/ml
5 μg/ml
Tris-HCl pH=7.6
MgCl2
EGTA
NaCl
pNO2PhePO4
β-glycerophosphate
DTT
NP-40
Na3VO4
NaF
PMSF
Leupeptin
Aprotinin
SBTI
Benzamidine
Antipain
Pepstatin
Chymostatin
Stockopl.
25ml
50ml
100ml
1M
1M
0,5M
1M
625μl
375μl
750μl
2,125ml
0,0966g
0,321g
125μl
125μl
25μl
50μl
250μl
25μl
25μl
25μl
25μl
12,5μl
12,5μl
12,5μl
1,25ml
750μl
1,5ml
4,25ml
0,197g
0,6425g
250μl
250μl
50μl
100μl
500μl
50μl
50μl
50μl
50μl
25μl
25μl
25μl
2,5ml
1,5ml
3ml
8,5ml
0,39g
1,285g
500μl
500μl
100μl
200μl
1ml
100μl
100μl
100μl
100μl
50μl
50μl
50μl
200mM
20%
100mM
500mM
100mM
10mg/ml
10mg/ml
10mg/ml
100mM
10mg/ml
10mg/ml
10mg/ml
Praktische uitvoering:
Extractie van eiwitten voor expressie-analyse:
 Epjes met geoogste plantencellen worden uit de –80°C diepvries gehaald en vervoerd
in vloeibaar N2.
 Voeg in het epje met plantencellen 200 l extractiebuffer toe.
 De cellen worden in een mortier geplet.
 Vortex de oplossing en breng het epje in vloeibaar N2 (herhaal 2 maal).
 Vortex totdat de oplossing ontdooit.
 Centrifugeer 15 min bij 14.000 rpm en 4°C.
 Neem supernatans af.
69
Deel 3: Materiaal en Methoden
 Centrifugeer 15 min bij 14.000 rpm en 4°C.
 Doe 200 l supernatans in een nieuw epje.
 In een ander epje maken we een 1/20 verdunning: 2 l extract + 38 l water.
3.6.1.1 Proteïne-concentratiebepaling van proteïne-extracten (bereid met HB-buffer) van
Arabidopsis celsuspensies volgens de methode van Bradford.
Benodigdheden:

Eiwitextract

100 mg / ml BSA stockoplossing

BIO-RAD kleuroplossing (270 µl / well):
– 60 µl BIO-RAD protein-dye
– 210 µl steriel water
Maak deze oplossing net voor gebruik aan.

NUNC polysorp microtiterplaten

colorimetrische microtiterplaat-reader met Soft Max Pro software
Praktische uitvoering:

Maak een BSA-oplossing van 100 µg / ml

Neem als blanco 30 µl water (in duplo)

Maak uit de BSA-oplossing van 100 µg / ml volgende standaardreeks in de welletjes
van de microtiterplaat aan.
Maak de standaardreeks in duplo.
– standaard 1 = 1 µg/ml: 3 µl BSA
+ 27 µl H2O
– standaard 2 = 2 µg/ml: 6 µl BSA
+ 24 µl H2O
– standaard 3 = 4 µg/ml: 12 µl BSA
+ 18 µl H2O
–
–
–
standaard 4 = 6 µg/ml: 18 µl BSA
standaard 5 = 8 µg/ml: 24 µl BSA
standaard 6 = 10µg/ml: 30 µl BSA
+ 12 µl H2O
+ 6 µl H2O
+ 0 µl H2O

Maak van het staal een 1/1200 en een 1/3000 verdunning in steriel H2O:
Maak eerst een 1/20 verdunning in H2O in een epje: 2 µl staal + 38 µl H2O.
Maak in de microtiterplaat een 1/6 verdunning: 5 µl van het 1/20 verdunde staal + 25
µl steriel H2O
Maak in de microtiterplaat een 1/15 verdunning: 2 µl van het 1/20 verdunde staal + 28
µl steriel H2O

Door het toevoegen van de 270 µl kleuroplossing zal dan een laatste 1/10 verdunning
gebeuren.
70
Deel 3: Materiaal en Methoden

Voeg met de multi-chain pipet 270 µl BIO-RAD kleuroplossing toe

Sluit de plaat af en laat 10 min schudden.

Meet de absorptie bij 600 nm m.b.v. de colorimetrische microtiterplaat-reader.
3.6.2. SDS-PAGE
Om een eiwit te visualiseren en de vorderingen in de opzuivering duidelijk te kunnen volgen,
worden de eiwitten eerst gescheiden via SDS-PAGE.
Dit is een vorm van eiwitscheiding waarbij het eiwitmengsel over een polyacrylamide gel
gebracht wordt en waarbij de scheiding zal gebeuren op basis van het moleculair gewicht van
de eiwitten. Door het SDS (Sodium Dodecyl Sulphate ) in de gebruikte buffers worden de
eiwitten volledig ontvouwen en negatief geladen, zodat de scheiding enkel op het moleculaire
gewicht van de eiwitten gebaseerd is.
3.6.2.1. De polyacrylamide gel
De polyacrylamidegel wordt gevormd door polymerisatie van monomeer acrylamide tot
lineaire ketens en door cross-linking van deze ketens met N,N’-methyleen bisacrylamide
(BIS) (Figuur 3.8).
De resolutie van de gel wordt bepaald door de concentratie van acrylamide en bisacrylamide,
hoe meer bisacrylamide, hoe meer cross-linking kan optreden en hoe meer de zeefstructuur
van het gel de grotere moleculen afremt.
De polymerisatie wordt geïnitieerd door het toevoegen van vrije radicalen (APS, ammonium
persulfaat). Ook TEMED wordt toegevoegd om de vrije radicalen te stabiliseren.
Fig. 3.8: polymerisatie van acrylamide en bis-acrylamide
71
Deel 3: Materiaal en Methoden
De gel wordt tussen 2 glazen platen gegoten. Bij discontinue elektroforese wordt het gel
opgebouwd uit een laag ‘stacking’ gel en een laag ‘running’-of separating gel.
De bovenste laag van het gel is de ‘stacking gel’(zie figuur). Hierin bevinden zich de slotjes
waarin het staal geladen zal worden (Figuur 3.9).
Deze laag zal de eiwitten niet scheiden maar onder andere door de pH en de grofmazigheid
van de ‘stacking’ gel zullen de eiwitten zodanig gestapeld worden, vlak boven de separating
gel, dat alle eiwitten gelijktijdig zullen vertrekken wanneer ze doorheen de separating gel
migreren.
In de separating gel zullen de eiwitten met een verschillende snelheid doorheen het gel
migreren, afhankelijk van hun moleculair gewicht.
De kleinere eiwitten zullen minder geremd worden door de gel, de grotere eiwitten zullen
meer afgeremd worden door de ‘cross-linking’ van het polyacrylamide.
Fig. 3.9: SDS-PAGE
72
Deel 3: Materiaal en Methoden
Buffersamenstelling
Separating gel
MQ H2O
30% Acrylamide
1 M Tris-HCl
pH 8,7
10% SDS
10% APS
Temed
10 ml
10%
2,75 ml
3,3 ml
3,75 ml
12%
2,05 ml
4,0 ml
3,75 ml
15%
1,05 ml
5 ml
3,75 ml
17%
0,35 ml
5,7 ml
3,75 ml
60 ml
12%
12,3 ml
24 ml
22,5 ml
100 µl
100 µl
10 µl
100 µl
100 µl
10 µl
100 µl
100 µl
10 µl
100 µl
100 µl
10 µl
600 µl
300 µl
30 µl
Stacking gel
MQ H2O
30 % Acrylamide
1 M Tris-HCl pH 6,8
10% SDS
10% APS
Temed
10 ml
6,8 ml
1,7 ml
1,25 ml
100 µl
100 µl
10 µl
30 ml
20,4 ml
5,1 ml
3,75 ml
300 µl
150 µl
15 µl
Sample buffer 5x
1 M Tris-HCl pH 6,8
10% SDS
600 mM DTT
Bromophenolblauw
Glycerol
MQ H2O
3,5 ml
1g
0,93 g
1,2 mg
3 ml
3,5 ml
Running buffer 10x, 1000ml, pH 8,3
0,25 M Tris-HCl
30,25 g
1,92 M glycine
144 g
35 mM SDS
10 g
MQ H2O
Adjust to 1000 ml
 voor gebruik 10x verdunnen (100 ml + 900 ml MQ H2O)
73
Deel 3: Materiaal en Methoden
3.6.2.2. Behandelen van het staal
De staaltjes worden, voor ze over de gel te brengen, 10’ opgekookt in sample buffer bij 95°C.
Deze bevat SDS, glycerol, broomfenolblauw en DTT.
SDS is een anionisch, denaturerend detergens dat eiwitten lineariseert zodat deze geen
tertiaire of quaternaire structuur meer vertonen (Figuur 3.10).
Fig. 3.10: linearisatie van het eiwit door middel van SDS
Bovendien wordt de lading die eigen was aan het eiwit volledig gemaskeerd door de
negatieve ladingen van het SDS, de eiwitten zullen dus allemaal negatief geladen zijn en
zullen migreren naar de positieve pool wanneer ze in een elektrisch veld geplaatst worden.
Het DTT zal de eventuele disulfidebruggen van het eiwit verbreken en zo meewerken aan de
linearisatie van het eiwit.
Er wordt ook broomfenolblauw aan het staal toegevoegd om de migratie van de eiwitten op
het gel zichtbaar te kunnen volgen.
Glycerol wordt toegevoegd om het staal te ‘verzwaren’ en het laden te vergemakkelijken.
Bovendien wordt het staal ook nog gedurende 10 minuten gekookt bij 95°C, dit om optimale
denaturatie te bekomen.
De gel wordt in elektrodebuffer geplaatst en spanning wordt over het geheel gebracht. De
negatief geladen eiwitten migreren naar de positieve pool met een snelheid die omgekeerd
evenredig is met hun moleculair gewicht.
74
Deel 3: Materiaal en Methoden
Om een zicht te krijgen op het moleculair gewicht van de eiwitten, wordt samen met de
staaltjes een proteïne merker geladen. Deze loopt mee samen met de moleculen en aan de
hand van de gekende waarden van de merker kan het moleculaire gewicht geschat worden.
Praktische uitvoering

Glasplaatjes wassen met zeep, vervolgens goed spoelen met water en EtOH, afdrogen met
cleenex na 2’ drogen aan de lucht.

Plaats de houder op een staander, breng spacers tussen groot en klein glasplaatje en breng
dit in de houder en span deze voorzichtig aan. Controleer of de onderzijde van de 2
glasplaatjes mooi recht is.

Separating gel maken: (10 mL / 2 gels) (handschoenen gebruiken). Opgelet: APS en
TEMED pas op einde toevoegen.

Vlug overpipetteren tussen plaatjes (1 cm onder kammetje).

Isobutanol (H2O-saturated) toevoegen om luchtbellen te verwijderen en de ‘running gel’
recht te trekken.

Laten stollen 10’

Isobutanol verwijderen, naspoelen met water, drogen met dun filterpapier (gel niet
aanraken)

Stacking gel maken: (5 mL / 2 gels) (handschoenen gebruiken)

Stacking boven separating gel pipetteren.

Kammetje schuin inbrengen, luchtbellen verwijderen; volledig opvullen met stacking.

Laten stollen.

1x SDS-loopbuffer (running buffer) in buffervat vullen.

Kammetje verwijderen en naspoelen met water.

Resterend water met cleenex opzuigen.

Gels vastklikken in elektrodebad.

Eiwitoplossing + ladingsbuffer (+DTT om de S-bruggen te reduceren; 5x) in eppje.

10’ opkoken in incubator bij 95°C.

Laden van gel: 60 g staal.

Loop gel bij 180 V, constante voltage of bij 25 mA per gel, constante ampérage
gedurende 1 uur (tot blauw front van de gel gelopen is).
75
Deel 3: Materiaal en Methoden
3.6.3. Western Blot
In deze thesis werd uitsluitend “Wet western blotting” gebruikt.
De eiwitten die gescheiden werden op gel, kunnen overgebracht worden op een membraan.
Ze zullen naar het membraan migreren onder invloed van een aangelegde spanning naar de
positieve pool toe. De niet bezette plaatsen op het membraan moeten nu echter nog bezet
worden, zoniet zal het detectie-antilichaam niet-specifiek op het membraan binden.
Buffersamenstelling:
Voor 1 L transferbuffer of (wet) blotbuffer:
10x Tris Glycine
100 ml
Water
750 ml
MeOH
150 ml
Zet de buffer koud.
Praktische uitvoering:

Bereidt voldoende transferbuffer om de transferbuffer tank te vullen en een extra 200
ml om het gel en membraan te equilibreren en om het Whatman 3MM filterpapier
nat te maken.

Snijdt de stacking gel uit en verwijder de gel uit diens cassette.

Dompel de gel 10 à 30 min lang in de transferbuffer .

Breng het filterpapier minstens 30 s lang in de transferbuffer.

Knip het Immobilon membraan in het aantal nodige stukken van 6,6 cm x 8,6 cm.

Bevochtig het membraan 15 s lang in methanol.

Plaats het membraan vervolgens 2 min in MQ H2O.

Plaats het membraan vervolgens 5 min in transferbuffer en laat het minstens 5 min
equilibreren.

Open het mapje (cassette houder)

Plaats op de zwarte kant een vochtige spons en plaats hierop 2 vochtige Whatman
filterpapiertjes.
76
Deel 3: Materiaal en Methoden

Leg hierop de gel. Plaats op de gel met de holle kant een PolyVinylidine DiFluoride
(PVDF) membraan, aandrukken om luchtbellen te vermijden.

Plaats hierop 2 vochtige Whatman filterpapiertjes, aandrukken om luchtbellen te
vermijden.

Plaats hierop een vochtige spons. En rol met een pipet heen en weer over dit alles om
luchtbellen weg te krijgen en sluit dan het mapje.

Plaats het mapje zo in de transfertank, zodanig dat de gel-zijde van de cassettehouder
gericht is naar de kathode (-) en de membraanzijde gericht is naar de anode (+).

Vul de transfer tank met de gekoelde transferbuffer.

Voeg een roermagneet en blok ijs hierbij. Na een uur zal het blok ijs gesmolten zijn en
moet deze vervangen worden.

Plaats deze opstelling op een roerplaat.

Verbindt de anode (zwart) en kathode (rood) met de corresponderende ingangen op de
transfereenheid.

Stel in: constante ampérage, 270 mA (= 0,27 A) voor 1 uur.

Na een uur vervang je het ijs en gebruik je dezelfde instellingen voor wederom een
uur.

Na de transfer verwijder je de cassettehouder uit de tank .
3.6.4. Immunodetectie
Standaard immunodetectie wordt uitgevoerd op proteïnen na western blot. Het ongebonden
membraan bindingsplaatsen op het vochtige membraan (blot) worden geblokkeerd met
blocking reagens. Het membraan wordt geïncubeerd met een primair antilichaam tegen het
proteïne van interesse. Vervolgens wordt een secundair antilichaam toegevoegd, geconjugeerd
met een enzym, horse radish peroxidase (HRP) of alkalisch fosfatase bijvoorbeeld, dat het
primaire antilichaam herkent. Dit enzym wordt gebruikt om de proteïne van interesse te
vizualiseren. Met HRP, H2O2 en luminol wordt licht geproduceerd dat opgevangen kan
worden op een autoradiogram.
Buffersamenstelling:
1L TBT buffer:
10x TBS buffer
100 ml
Water
900 ml
Triton X-100
1 ml
77
Deel 3: Materiaal en Methoden
Blocking buffer:
Melkpoeder (3%)
1,5g
1x TBT buffer
50 ml
Praktische uitvoering:
Antilichaam incubatie

Plaats de blot in afgeroomd melk (3%) en zet het voor 1 uur op een shaker bij KT (of
overnacht bij 4°C).

Plaats de blot in 10 ml TBS-T buffer (en 3% afgeroomd melk) met de primaire
antilichaam oplossing en incubeer 1 uur lang op een shaker bij kamertemperatuur.

Was de blot in 10 ml TBS-T buffer en incubeer 10 min lang op een shaker bij
kamertemperatuur.

Was de blot in 10 ml TBS-T buffer en incubeer 5 min lang op een shaker bij
kamertemperatuur. Doe dit 2 maal, telkens met verse TBS-T buffer.

Plaats de blot in 10 ml TBS-T buffer (en 3% afgeroomd melk) met de secundaire
antilichaam (geconjugeerd met horse radish peroxidase) oplossing en incubeer 1 uur
lang op een shaker bij kamertemperatuur.

Was de blot in 10 ml TBS-T buffer en incubeer 10 min lang op een shaker bij
kamertemperatuur.

Was de blot in 10 ml TBS-T buffer en incubeer 5 min lang op een shaker bij
kamertemperatuur. Doe dit 2 maal, telkens met verse TBS-T buffer.
3.6.4.1. Enhanced Chemiluminescence (ECL) detectie
Detectie met behulp van HRP (Horse Radish Peroxidase)

Droog de blots tussen 2 papieren doekjes, goed aandrukken (niet langer dan 30s).

Substraat van HRP uit de koelkast (4°C) halen:
-
Western Lightning chemiluminescence Reagens plus: Luminol (donker flesje).
-
Western Lightning chemiluminescence Reagens plus: Oxidizing reagent.
78
Deel 3: Materiaal en Methoden

Per blot: 2 ml luminol + 2 ml oxiderende reagens. Breng dit in een plastieken schaal
en laat 1 min schudden.

Droog de blots wederom tussen 2 papieren doekjes, goed aandrukken.

Neem Saran plastiek folie, plaatst het op de filmcassette en plak het onderaan vast.

Plaats hierop de blotjes.

Plooi het niet vastgekleefde gedeelte van de folie over de blotjes en kleef dan de
hoekjes vast.

Met behulp van autoradiogrammen (mogen niet in contact komen met licht!) van
Amersham maken we in de donkere kamer foto’s.

Maak een kleine vouw in de linker benedenhoek van het autoradiogram en plaats het 5
tot 30 s (of langer bij zwakke detectie) op de blots.

Plaats het belichte autoradiogram horizontaal in de machine.
3.6.4.2. Alkalisch fosfatase detectie
Principe:
Onder invloed van alkalisch fosfatase zal BCIP (5-bromo-4-cloro-3-indolylfosfaat)
gedefosforyleerd worden. Onder alkalische omstandigheden treedt er dimerisatie op waardoor
dehydro-indigo wordt gevormd. Er worden tevens protonen gevormd die NBT (nitroblue
tetrazolium) reduceren. Het NBT zal neerslaan onder de diformozan-vorm (onoplosbaar en
paars).
Gebruikte oplossingen:

NBT
30 mg NBT / 1mL 70% DMF

BCIP
15 mg BCIP / 1mL 100% DMF (max. 3 maanden bij 4 oC)

NBT/BCIP-buffer
(max. 3 maanden bij 4 oC)
0.1 M NaHCO3
1 mM MgCl2
pH 9,8
79
Deel 3: Materiaal en Methoden
Practische werkwijze:

Giet de blokbuffer af.

Incubeer het membraan 1h30 in primair antilichaam verdund in blokbuffer.

Was het gel 3x met PBS gedurende 5' in schaaltje.

Voeg secundair antilichaam toe verdund in blokbuffer.

Na toevoegen van het antilichaam dat geconjugeerd is met alkalisch fosfatase (dit kan
primair, secundair, tertiair… zijn) opnieuw 3x wassen met PBS gedurende 5'.

Breng het membraan met een pincet over in een blauw schaaltje.
Verdun NBT en BCIP 100x in NBT/BCIP-buffer en incubeer het membraan in deze oplossing
tot bandjes duidelijk zichtbaar zijn.
80
Deel 3: Materiaal en Methoden
3.6.5. TAP (CBPZZ) protocol
Materiaal:
1. Buffers:

Extractiebuffer: 25 mM TrisHCl pH 7,6, 15 mM MgCl2, 5 mM EGTA, 150 mM
NaCl, 15 mM pNO2PhePO4, 60 mM beta-glycerofosfaat, 0.1% NP-40, 0.1 mM
Na3VO4, 1 mM NaF, 1 mM DTT, 1 mM PMSF, 10 µg / ml leupeptine, 10 µg / ml
aprotinine, 5 µg / ml antipaïne, 5 µg / ml chymostatine, 5µg / ml pepstatine, 10 µg / ml
SBTI, 0.1 mM benzamidine, 1 µM E64, 5% ethyleenglycol

IgG-Sepharose wasbuffer: 10 mM Tris HCl pH 8, 150 mM NaCl, 0.1 % NP-40, 5%
ehtyleenglycol

TEV buffer: 10 mM Tris HCl pH 8, 150 mM NaCl, 0.1 % NP-40, 0.5 mM EDTA, 1
mM DTT, 1µM E64, 5% ethyleenglycol

Calmodulin bindingsbuffer: 10 mM Tris HCl pH 8, 150 mM NaCl, 0.1 % NP-40, 10
mM beta-mercaptoethanol, 1 mM imidazol, 2 mM CaCl2, 1 mM MgAc, 5%
ethyleenglycol

Calmodulin elutiebuffer: 10 mM Tris HCl pH 8, 150 mM NaCl, 0.1 % NP-40, 10
mM beta-mercaptoethanol, 1 mM imidazol, 25 mM EGTA, 5% ethyleenglycol
81
Deel 3: Materiaal en Methoden
2. Affiniteits matrices:

IgG Sepharose 6 Fast Flow (Amersham)

Calmodulin Affinity resin (Stratagene)
Werkwijze:
Maken van eiwitextract:

Verzamel het plantmateriaal op een glasfilter, in vloeibare stikstof invriezen en
bewaren bij -80C. Vul de mortier met vloeibare stikstof en breng hierin het
plantmateriaal (circa 15 g / TAP). Plantmateriaal pletten met gekoelde stamper tot
kleine brokjes en in falcon in –80°C.

Extraheer het plantmateriaal in extractie buffer door middel van mixen met behulp van
de ultra-Turax mixer (3 x 30sec blauwe stand):
-
Koel de ultra-Turax mixer staaf eerst in de diepvriezer.
-
De ultra-Turax mixer staaf eerst spoelen met extractiebuffer.
-
Plaats falcons in een beker met ijs en voeg extractie buffer toe (circa 1 ml /
gram cellen).
-
Mixen: eerst op de groene stand, eventjes op en neer gaan met de falcon, ga
vervolgens naar de blauwe stand, na 30 sec stoppen met mixen, vortex en op
ijs koelen.
-
Herhaal drie maal en breng extract in een centrifugebuis
-
Spoel de staaf nog eens met circa 3 ml extractiebuffer na, spoel hiermee de 2
falcons (falcons eerst even centrifugeren bij 1500 rpm) en breng ook in het
centrifuge buisje m.b.v p1000 pipet ( blauwe tip afknippen en op en neer
pipetteren).


Centrifugeer het extract 20 min lang bij 21.000 rpm in SS34 bij 4°C
-
Spoel de centrifuge buisjes vooraf met milliQ water
-
Vul met extract tot circa 2 cm van de rand (equilibreer op 0,5 g)
Centrifugeer vervolgens 45 min in SW-41 (Beckman ultracentrifuge) bij 38000rpm en
4ºC.
-
Equilibreer tot 0,01g
-
Breng eerst het supernatans van de vorige centrifuge stap in Beckman
polyallomer centrifugatie buisjes.
82
Deel 3: Materiaal en Methoden
3.6.5.1. TAP- zuivering
A) Equilibratie van Ig G parels met extractiebuffer (3 x 10 ml)

Pipetteer 1ml IgG Sepharose 6 Fast Flow (knip het tipje altijd eerst af voor je er beads
mee oppipetteert) in een 15ml falcon (circa 500 µl effectieve beads)

Was met 10ml extractiebuffer (20 kolomvolumes)

Spin 1500 rpm in gekoelde centrifuge 1 min lang.

Neem supernatans af en voeg 10 ml extractiebuffer toe (herhaal deze twee laatste
stappen 2 maal).

Breng beads over naar 50 ml falcon.
B) Incubatie van Ig G beads met extract, 1 uur lang bij 4°C

Filtreer het volledige extract over 0,45 m Alltech filter

Meet de eiwitconcentratie van het extract via Bradford (BIORAD protein assay)
-
Voeg in de cuvetjes 799 µl H2O + 200 µl Bradford reagens + 1 µl eiwitextract
-
15 min op kamertemperatuur laten staan
-
Blancometing gebeurt in een cuvetje met extractiebuffer (OD bij 595 nm).
-
Elke staal wordt in duplo gedaan. Men neemt dan het gemiddelde optische
densiteit (OD) van de stalen.

Voeg het extract (circa 200 milligram proteïne) toe aan de beads en incubeer 1 uur
lang op een roterend wiel bij 4C in de koude kamer.
C) Wassen van Ig G Sepharose

Centrifugeer 1 min bij 1500 rpm en 4°C.

Verwijder supernatans.

Pipetteer beads op met blauw tipje met afgesneden punt (eerst op en neer pipetteren).

Breng beads over in een Miacol kolom en vang de wasbuffer op in een 15 ml falcon.

Spoel de grote falcon met circa 1 ml Ig G wasbuffer.

Was de IgG Sepharose met 1 x 10ml IgG-Sepharose wasbuffer en 1x 5 ml TEV-buffer
in de Miacol kolom.

Breng het staal (beads) in een 1,5 ml eppendorf.

Short spin 1500 rpm.

Neem supernatans af.
83
Deel 3: Materiaal en Methoden

Voeg 500µl TEV-buffer en 100U (1 µl = 10 U) AcTEV (Invitrogen) toe. Incubeer 1
uur lang bij 16C op een draaiend wiel. Voeg na 30 min een extra hoeveelheid 100U
AcTEV toe. Bij eiwitten die onstabiel zijn bij 16°C (bvb cyclines) wordt de TEVincubatie overnacht bij 4°C gedaan.

Filter TEV-eluaat over Miacol kolom en vang op in epje.
D) Equilibratie van calmoduline affiniteits resin

Pipetteer 1ml beads (500 µl effectief beads) (afgesneden tip) in een Miacol kolom

Was met 10 ml calmoduline bindingsbuffer

1 min centrifugeren bij 1500 rpm en neem supernatans af ( herhaal 2 x)

Verdeel de beads gelijkmatig over twee 5 ml falcons

1 min centrifugeren bij 1500 rpm en neem supernatans af
E) Incubatie van TEV-eluaat met calmoduline beads

Was Ig G beads 2 x met 750 µl CBB (met EDTA vrije Complete protease inhibitor) en
vang op bij TEV-eluaat.

Vang het op bij het eluaat in 5 ml buisje.

Voeg 1 mM CaCl2 toe (1 µl van 1 M stock)

Voeg 500 µl beads toe

Incubeer 1 uur op draaiend wiel in de koude kamer

Centrifugeer 1 min bij 1500 rpm

Neem supernatans af.
F) Wassen van calmoduline beads met CBB

Pipetteer beads in een Miacol kolom.

Was de beads in 10 ml CBB (spoel 5 ml buisje), de wasbuffer wordt opgevangen in
een 15 ml falcon.
G) Elutie van calmodulinebeads

Elueer de kolom met 2,5 ml calmoduline elutiebuffer. Vang op in 5 fracties van 500 µl
( zonder CaCl2 ; met EDTA).

Vang op in 5 ml buisjes en verdeel uit over twee 2 ml epjes

Voeg TCA toe (finaal 25%) om de eiwitten te concentreren.
84
Deel 3: Materiaal en Methoden

Overnacht op ijs in de koude kamer.

Centrifugeer bij 14.000 rpm

Was pellet 2 x in 0,5 ml Aceton-HCl (aceton gaat de resten TCA verwijderen)

Na het wassen wordt het aceton weggezogen

Laat de pellet op ijs aan de lucht drogen (span over de ijsbak Saran plastiekfolie)

Bewaar de pellet bij – 80°C.
H) Analyse
 Analyse van de zuivering: via western blot met -CBP na SDS PAGE
 Identificatie van interactoren:
-
Scheiding van eiwitten op 4-12% NUPAGE
-
Visualisatie met Coomassie G250
-
Uitsnijden van de bandjes
-
Trypsine digest
-
MS: MALDI-TOF / MSMS
85
Deel 4: Resultaten en discussie
Deel 4. Resultaten en discussie
4.1. Optimalisatie van transgenexpressie door toevoeging van introns.
Uit eerdere experimenten weet men dat de expressie van geTAP-tagged bait eiwit onder
controle van diens natieve promotor veel lager ligt dan de expressie van het endogene eiwit.
Het is echter van primair belang dat de accumulatie van het recombinante eiwit hoog is om in
competitie te kunnen treden met het endogene eiwit en zodoende een zuivering te bekomen
van een voldoende aantal complexen om de co-gezuiverde eiwitten te kunnen identificeren. Er
worden bv. minder interactoren gedetecteerd bij de expressie van het CDKA;1-TAP construct
onder controle van een endogene promotor in vergelijking met een constitutieve promotor.
Om de expressie van het transgene eiwit onder controle van de endogene promotor te
verhogen werden enkele strategieën uitgetest.
Een eerste manier was het toevoegen van introns aan de coderende sequentie van de bait, dit
zou de mRNA accumulatie kunnen stimuleren en ook de translationele opbrengst kunnen
verhogen (zie paragraaf 1.4.).
4.1.1. Kloneringsstrategie
4.1.1.1. Oppikken van genen via PCR
BAC-isolatie
Om onze genen met introns op te pikken werden BAC-klonen gebruikt (BAC = bacterial
artificial chromosome). Arabidopsis thaliana bezit 5 chromosomen. Het volledige genoom
van Arabidopsis thaliana werd in verschillende kleinere fragmenten gesplitst, vervolgens
werd elk fragment gekloneerd in een BAC-plasmide.
De BAC-klonen werden als template gebruikt om de volgende genen met introns op te
pikken: CDKA;1 / CDKB1;1 / CKS;1 / CycD3;1. Eerst werd er dus BAC-plasmide bereid dat
vervolgens als template in een adaptor-PCR reactie gebruikt werd: een overnacht cultuur werd
ingezet van de BAC-klonen bij 37°C in LB+ medium met chloramphenicol (voor CDKA;1 en
CDKB1;1) enerzijds en kanamycine (voor CKS;1 en CycD3;1) anderzijds. Vervolgens werd
het BAC-DNA geïsoleerd.
86
Deel 4: Resultaten en discussie
Adaptor-PCR:
Primers voor het oppikken van onze genen met introns:
De primers voor het oppikken van de genen werden geconstrueerd op basis van de sequentieinformatie over de genen, verkregen via de TAIR-homepage (http://www.arabidopsis.org/):
de zoekoptie laat toe om het gen van interesse op te sporen, via sequenceviewer kan het
gewenste genlocus in beeld gebracht worden. Voor de forward (fwd) primer werd de
sequentie vanaf het ATG-startcodon tot een 20-tal nucleotiden stroomafwaarts genomen. De
reverse (rev) primer bevat de 20 nucleotiden stroomopwaarts van het stopcodon. Afhankelijk
van de finale gewenste TAP-fusie, N- of C- terminaal, werd het stopcodon opgenomen
respectievelijk weggelaten. De primers eindigen op G of C nucleotiden omdat deze via 3
waterstofbruggen met hun complemente base gebonden zijn en dus stabieler dan T of A
(enkel 2 waterstofbruggen), wat tot een hogere PCR-opbrengst kan leiden.
Specifieke sequenties van de primers voor het oppikken van de 4 genen :
CDKA;1 (chromosoom 3, locus: AT3G48750)
Fwd primer: ATGGATCAGGTTGGTGTAAATAG
Rev primer: AGGCATGCCTCCAAGATCCTTG
CDKB1;1 (chromosoom 3, locus: AT3G54180)
Fwd primer: ATGGAGAAGTACGAGAAGCTAGAGAAGG
Rev primer: GAACTGAGACTTGTCAAGGC
CKS;1 (chromosoom 2, locus: AT2G27960)
Fwd primer: ATGGGTCAGATCCAGTACTCCG
Rev primer: CTTAGCAATCTGAGCTTGGTGC
CycD3;1 (chromosoom 4, locus: AT4G34160)
Fwd primer: ATGGCGATTCGGAAGGAGGAAGAAAG
Rev primer: TGGAGTGGCTACGATTGCCCATGGC
87
Deel 4: Resultaten en discussie
Aan de forward primers werd aan het 5’-uiteinde een
attB1-sequentie toegevoegd en bij de reverse primers een
attB2-sequentie. Zo werden de genen na adaptor-PCR,
met de BAC-klonen als template, aan beide uiteinden
verlengd met een att(achment)-sequentie (zie figuur 4.1).
Deze att-sites laten homologe recombinatie toe met het
plasmide pDonr221.
Fig. 4.1: Oppikken van genen en
voorzien
van att-sites via adaptor-PCR
M
1
2
3
4
5
6
7
8
M: 2 L Smartladder
1: 10 L PCR mix CDKA;1 zonder stop
2: 10 L PCR mix CDKA;1 met stop
1500 bp
1000 bp
800 bp
600 bp
3: 10 L PCR mix CDKB1;1 zonder stop
4: 10 L PCR mix CDKB1;1 met stop
5: 10 L PCR mix CKS;1 zonder stop
6: 10 L PCR mix CKS;1 met stop
7: 10 L PCR mix CycD3;1 zonder stop
Fig. 4.2: Analyse van adaptor-PCR via agarosegelelektroforese
8: 10 L PCR mix CycD3;1 met stop
De groottes van de opgepikte genen werden ook via de TAIR-website opgespoord:

CDKA;1 is 2056 bp groot

CDKB1;1 is 1366 bp groot

CKS;1 is 650 bp groot

CycD3;1 is 1399 bp groot
Bij de controle op agarosegel (Figuur 4.2) ziet men bij CDKA;1 (met en zonder stopcodon)
onderaan de geamplificeerde primers, wat wijst op het mislukken van de PCR-amplificatie.
Eerst werd verondersteld dat er te weinig DNA uit de BAC-klonen was geïsoleerd, maar dit
bleek een verkeerde assumptie te zijn. De andere genen werden wel opgepikt (zie Figuur 4.2)
De adaptor-PCR werd herhaald, maar nu met genomisch DNA als template. Zo werd alsnog
CDKA;1 (met en zonder stopcodon) opgepikt (Figuur 4.3).
M
1
2
M: 2 L Smartladder
1: 10 L PCR mix CDKA;1
2000 bp
met stop
2: 10 L PCR mix CDKA;1
zonder stop
Fig. 4.3: Analyse van adaptor-PCR via agarosegelelektroforese
88
Deel 4: Resultaten en discussie
4.1.1.2. Constructie van Entry-vectoren
De 4 opgepikte genen werden als volgt via een Gateway™ BP-recombinatie reactie
gekloneerd in pDONR221 met productie van de entry-klonen als gevolg.:
Productie van pDONR 221 :
E. coli DB3.1 pDONR221 werd overnacht opgegroeid in LB+ met kanamycine (Km) voor
Nucleobond Midi AX100 plasmidebereiding (zie paragraaf 3.4.3.1.). De volgende dag werden
de cellen geoogst via centrifugatie en werd het plasmide-DNA hieruit bereid.

De optische densiteit van het plasmide-DNA werd bepaald met een Beckman
fotospectrometer bij 260 nm:
[DNA] = 50 g/mL x gemeten OD260
De BP-recombinatie reactie:
Tijdens de BP-recombinatie reactie (zie paragraaf 3.4.7.1.). is het belangrijk om het PCRproduct en de donor-vector in equimolaire hoeveelheden toe te voegen. Standaard werd 100
fmol gebruikt.

Van femtomol naar nanogram:
1 ng DNA = (x fmol)(N)(660 fg /fmol) (1 ng/106 fg) waarbij N de lengte van het DNA
voorstelt.
Bv. CDKA1;1 = 2056 bp + lengte van de 2 att-sites (= 2 x 25bp) = 2106 bp.
100 fmol x 2106 bp x 660/106 = 140 ng (dezelfde berekening voeren we ook uit met
de andere genen)


[pDONR 221] = 290 ng/l
lengte van pDONR 221 = 4759 bp
Dus 100 fmol x 4759 bp x 660/106 = 314 ng

100 fmol  314 ng/290 ng/l  1,1l
Vervolgens werd via Nanodrop de concentratie van ons PCR-product bepaald.
Bv. CDKA1;1 zonder stopcodon:
100 fmol CDKA;1 = 140 ng
Via Nanodrop : [CDKA;1] = 346,47 ng/l

140 ng / 346,47 ng/l = 0,4 l
Bij de BP-recombinatie reactie werd dus 1,1 l pDONR 221 gebruikt en 0,4 l CDKA;1
(zonder stop)
89
Deel 4: Resultaten en discussie
De BP-recombinatie reactie werd overnacht uitgevoerd bij 25°C.
Er nam dus een recombinatie reactie plaats tussen de attB-sites
van onze genen (het PCR-product) en de attP-sites van
pDONR221 (Figuur 4.4). Dit resulteert in een pEntry-plasmide
met attL-sites. Vervolgens werd de BP-recombinatie reactie, en
dus de gevormde pEntry-plasmiden met de genen naar E. coli
DH5 getransformeerd via heatshock. Getransformeerde cellen
werden geselecteerd op LB+ Km50 platen. Met behulp van het
software programma VectorNTI10 (Invitrogen) werden in
parallel de pEntry-plasmiden in silico bekomen na BPrecombinatie reactie (Figuren 4.5, 4.6, 4.7, 4.8 ). Hierop werd
vervolgens een restrictiekaart gevisualiseerd. Deze analyse liet
ons toe om transformanten te controleren via restrictiedigest (zie
Fig. 4.4: Via BP recombinatie reactie wordt het
“control of celldeath” CcdB gen vervangen door
het gen van interesse.
paragraaf 3.4.5.), na een mini plasmidebereiding.
Controle restrictiedigest:
Fig. 4.5: pEntry L1L2-CDKA;1-Intron
I
Voor “pEntryL1L2-CDKA;1 intron (met en zonder stop)“ werden de restrictie-enzymen
BamHI en HindIII (Promega) gekozen omdat ze beide 100% activiteit vertonen in buffer E
(Promega). De verwachte fragmenten zijn 3298 bp en 1305 bp groot (Figuur 4.5).
90
Deel 4: Resultaten en discussie
attL2
T7 promoter
EcoRV (103)
T7 primer
M13 reverse primer
C D KB 1;1 intron
K an(R )
pEntry L1L2-CDKB1;1 intron
3916 bp
XhoI (2645)
attL1
M13 (-20) forward primer
M13 (-40) forward primer
Fig. 4.6: pEntry L1L2-CDKB1;1Intron
Voor “pEntryL1L2-CDKB1;1 intron (met en zonder stop)“ werden de restrictie enzymen XhoI
en EcoRV (Promega) gekozen omdat ze beide goede activiteit vertonen in buffer D
(Promega). De verwachte fragmenten zijn 2540 bp en 1373 bp groot (figuur 4.6).
Fig. 4.7: pEntry L1L2-CKS1Intron
Voor “pEntry L1L2-CKS1 intron (met en zonder stop)“ werden de restrictie enzymen SacII en
XmnI (Promega) gekozen omdat ze beide goede activiteit vertonen in buffer C (Promega). De
verwachte fragmenten zijn 499 bp en 2686 bp groot (Figuur 4.7).
91
Deel 4: Resultaten en discussie
Fig. 4.8: pEntry L1L2-CycD3;1-Intron
Voor “pEntry L1L2-CycD3;1 intron (met en zonder stop)“ werden de restrictie enzymen XbaI
en EcoRV (Promega) gekozen omdat ze beide goede activiteit vertonen in buffer C
(Promega). De verwachte fragmenten zijn 1053 bp en 2893 bp groot (figuur 4.8).
Na restrictiedigestie werd het restrictie reactiemengsel geladen op agarosegel om te zien of
men de verwachte fragmenten bekwam (Figuren 4.9, 4.10, 4.11).
M
1
3
2
4
5
6
7
8
9
10
M: 2 L Smartladder
1: 20 L CDKA;1_intron zonder stop
6000 bp
4000 bp
3000 bp
2000 bp
1500 bp
2: 20 L CDKA;1_intron zonder stop
1000 bp
5: 20 L CDKA;1_intron met stop
3: 20 L CDKA;1_intron zonder stop
4: 20 L CDKA;1_intron zonder stop
6: 20 L CDKA;1_intron met stop
7: 20 L CDKA;1_intron met stop
8: 20 L CDKA;1_intron met stop
9: 20 L CDKB1;1_intron zonder stop
Fig. 4.9: Analyse van de restrictiedigest van de entry-klonen
via agarosegelelektroforese.
M
1
2
3
4
5
6
7
8
10: 20 L CDKB1;1_intron zonder stop
9
10
M
M: 2 L Smartladder
1: 20 L CDKB1;1_intron met stop
4000 bp
2500 bp
2500 bp
2000 bp
1500 bp
1000 bp
2: 20 L CDKB1;1_intron met stop
3: 20 L CDKB1;1_intron met stop
4: 20 L CDKB1;1_intron met stop
600 bp
400 bp
200 bp
Fig. 4.10: Analyse van de restrictiedigest van de entry-klonen via
agarosegelelektroforese.
5: 20 L CKS 1_intron zonder stop
6: 20 L CKS 1_intron zonder stop
7: 20 L CKS 1_intron zonder stop
8: 20 L CKS 1_intron zonder stop
9: 20 L CKS 1_intron met stop
10: 20 L CKS 1_intron met stop
92
Deel 4: Resultaten en discussie
M
1
2
3
4
5
6
7
8
9
10
M: 2 L Smartladder
1: 20 L CKS 1_intron met stop
2: 20 L CKS 1_intron met stop
3: 20 L CycD3;1_intron zonder stop
2500 bp
4: 20 L CycD3;1_intron zonder stop
1000 bp
5: 20 L CycD3;1_intron zonder stop
600 bp
400 bp
6: 20 L CycD3;1_intron zonder stop
7: 20 L CycD3;1_intron met stop
8: 20 L CycD3;1_intron met stop
Fig. 4.11: Analyse van de restrictiedigest van de entry-klonen via
agarosegelelektroforese
9: 20 L CycD3;1_intron met stop
10: 20 L CycD3;1_intron met stop
Kloon 1 t.e.m. 4 en kloon 7 werden gesequeneerd (Figuur 4.9). Kloon 2 t.e.m 9 van figuur
4.10 werden ook gesequeneerd en tenslotte werden uit figuur 4.11 alle klonen gesequeneerd.
Andere kolonies van CDKB1;1_intron zonder stop en CDKA;1_intron met stop werden
opgegroeid voor een mini DNA plasmidebereiding (zie paragraaf 3.4.3.2.) en hierop werd
opnieuw een restrictiedigest op uitgevoerd en daarna op agarose gel gebracht.
M
1
2
3
4
5
6
7
8
9
10
M: 2 L Smartladder
Laan 1 t.e.m 10 bevat
20 L CDKA;1_intron met
stop
800 bp
400 bp
200 bp
Fig. 4.12: Analyse van de restrictiedigest van de entry-klonen met
CDKA;1_intron met stop via agarosegelelektroforese
.
M
1
2
3
4
5
6
7
8
9
10
M: 2 L Smartladder
3000 bp
2000 bp
1500 bp
Laan 1 t.e.m 10 bevat
20 L CDKB1;1_intron zonder
stop
Fig. 4.13: Analyse van de restrictiedigest van de entry-klonen met
CDKB1;1_intron zonder stop via agarosegelelektroforese
Klonen die het voorspelde bandenpatroon gaven werden gesequeneerd. Van figuur 4.12
(CDKA;1_intron met stop) werden klonen 2 en 7 gesequeneerd en van figuur 4.13
(CDKB1;1_intron zonder stop) werden klonen 3, 6, 7 en 8 gesequeneerd. De resulterende
sequenties werden gealigneerd met de voorspelde gensequenties van de TAIR-webstek via
93
Deel 4: Resultaten en discussie
Bio-edit. Met behulp van een chromatogram van de sequentiebepaling werden in Finch TV de
mogelijke mutaties onderzocht. Er werd verder gewerkt met klonen die geen of enkel ‘silent
mutations’ tot gevolg hadden. Dat waren de entry-klonen met CDKA;1_intron zonder stop
(kloon 1, fig. 4.9), CDKA;1_intron met stop (kloon 7, fig 4.9) CKS1_intron zonder stop
(kloon 5, fig. 4.10), CKS1_intron met stop (kloon 1, fig 11), Cyc D3;1_intron zonder stop
(kloon 4, fig. 4.11), Cyc D3;1_intron met stop (kloon 9, fig 11) en CDKB1;1_intron met stop
(kloon 3, fig. 4.10). Deze werden opgegroeid in LB+ met kanamycine voor een Nucleobond
Midi AX100 DNA plasmidebereiding. Daarna werd de DNA-concentratie bepaald met een
fotospectrometer (Nanodrop) bij 260 nm.
4.1.1.3. Constructie van TAP-expressievectoren met introns
De LR-recombinatie reactie:
De opgepikte genen met introns werden vervolgens via multisite LR-reactie (zie paragraaf
3.4.7.2.) gerecombineerd met een destination-vector, om zo een expressievector te maken die
het gen van interesse gefuseerd aan de TAP-tag bevat onder controle van de endogene
promotor. Er werd dus een LR-recombinatie reactie uitgevoerd met drie entry-vectoren en 1
destination-vector, waarvan de pEntryL1L2-gen_intron (CDKA;1 / CDKB1;1 / CKS1 /
CycD3;1) zelf gemaakt werden (Figuur 4.14). De entry-plasmiden pEntryL4R1-Pend
(promotor), pEntryR2L3-TAP-tag en de destination-vector pKCTAP waren reeds voorhanden.
De reactie werd uitgevoerd in LRplus buffer m.b.v. LRplus clonase.
Voor de uitvoering van de reactie werd eerst bepaald hoeveel pEntryL 1 L2-gen_intron vector
aan de reactie toegevoegd moet worden, rekening houdend met het feit dat de 3 entryvectoren en de destination-vector opnieuw in equimolaire hoeveelheden (20 fmol) toegevoegd
moeten worden:
Bv. voor pEntryL1L2-CycD3;1_intron zonder stop:
Van femtomol om naar nanogram (zie formule paragraaf 4.1.1.2.) :
20 fmol x 3946 bp x 660/106 = 52 ng
Concentratiebepaling van de midiprep gaf: 74,3 ng/L

52 ng / 74,3 ng/L = 0,7L
Dus er werd voor de LR-recombinatie reactie 0,7L pEntryL1L2-CycD3;1_intron zonder stop
(52 ng) gebruikt. De berekening werd ook voor de andere plasmiden uitgevoerd.
94
Deel 4: Resultaten en discussie
Fig. 4.14: Een overzicht van het 3 fragment LR recombinatie reactie gebruikt voor de constructie van de C-terminale TAPexpressievectoren.
De LR-reactie mix werd vervolgens getransformeerd naar E. coli DH5 en uitgeplaat op
spectinomycine (Sp) bij 37°C overnacht. Voor de multisite-reacties met de genen
CKS1_intron en CycD3;1_intron konden na meerdere herhalingen geen kolonies (de LRreactie is hier dus niet gelukt) bekomen worden, voor CDKB1;1_intron en CDKA;1_intron
wel. Meestal kunnen er na transformatie van een LR-reactie slechts een aantal (1-50) kolonies
bekomen worden, er werd hier dus op de grens gewerkt. Na de nodige optimalisaties, zoals
meer zuivere DNA-bereidingen bv., zou het wel mogelijk moeten zijn om ook voor CKS1 en
CycD3;1 met introns expressievectoren te maken, maar door tijdsgebrek werd dit niet meer
gedaan.
De kolonies uit de LR-reactie werden opgegroeid voor miniprep DNA plasmidebereiding, en
werden gecontroleerd via restrictiedigest-analyse.
95
Deel 4: Resultaten en discussie
Controle restrictiedigest van de LR-reactie:
Voor de expressievector met het construct pKCTAP-Pend::CDKA;1_intron-TAP werd een
restrictiedigest met HindIII uitgevoerd. Deze digest gaf aanleiding tot 4 fragmenten, nl. 1457
bp, 1629 bp, 2290 bp en 9629 bp (Figuur 4.16).
De
expressievector
met
het
construct
pKCTAP-Pend::CDKB1;1_intron-TAP
werd
gedigereerd met EcoRI. Drie fragmenten werden verwacht, nl. 855 bp, 2048 bp en 9708 bp
en terug gevonden (Figuur 4.16).
M
1
2
M: 2 µL smartladder
10.000
8000
2500
2000
1500
1000
800
bp
bp
bp
bp
bp
bp
bp
1: pKCTAP-Pend::CDKA;1intron-TAP
2: pKCTAP-Pend::CDKB1;1intron-TAP
Fig. 4.16: Het restrictiedigest mengsel (20 L DNA per kloon) werd geanalyseerd via agarosegelelektroforese.
De kolonies uit de LR reactie werden opgegroeid voor midiprep DNA plasmidebereiding in
LB+ medium met spectinomycine, waarna de concentratie bepaald werd.
4.1.2. Transformatie naar PSB-d celsuspensie cultuur
4.1.2.1. Transformatie naar Agrobacterium tumefaciens
De expressievectoren werden eerst getransformeerd in Agrobacterium tumefaciens C58C1
RifR pMP90 via elektroporatie (zie paragraaf 3.5.2.). Er werd 1 g van de beide
expressievectoren getransformeerd en er werd geselecteerd op YEB-platen met rifampicine,
gentamycine en spectinomycine.
4.1.2.2. Transformatie naar PSB-d
Het TAP-construct zit tussen twee T-DNA ‘borders’ op de expressievector. Deze ‘borders’
bepalen welk DNA er getransformeerd wordt naar de plantencellen. De andere functies nodig
voor transfer van T-DNA naar het genomisch DNA van de plantencel worden voorzien door
het pMP90 plasmide in de Agrobacterium-stam. Transformatie van de plantencellen gebeurde
96
Deel 4: Resultaten en discussie
door co-cultivatie van de Agrobacterium cellen met 2 dagen oude PSB-d Arabidopsis thaliana
cellen in aanwezigheid van acetosyringone. Na twee dagen van co-cultivatie werden de
Agro’s weggewassen met MSMO-medium met agro-afdodende antibiotica, alvorens het cocultivaat uit te platen op selectief en agro-afdodend medium (zie paragraaf 3.5.3.). Na 2
weken werden getransformeerde cellen m.b.v. de Leica MZ16F fluorescentie microscoop
(met een Zeiss Axiocam werd gefotografeerd) gecontroleerd op GFP-aanwezigheid, wat wijst
op een stabiele integratie van het T-DNA in de cel. Voor beide constructen werd transgeen
callus gevonden (Figuren 4.17 en 4.18).
Fig. 4.17 : GFP-analyse van plantencellen met T-DNA met de
GFP cassette en het Pend::CDKAintron-TAP construct.
Fig. 4.18: GFP-analyse van een callus van plantencellen met
het Pend::CDKBintron-TAP construct
GFP-expresserende calli werden opgepikt en op een verse selectieve plaat gebracht als backup. Met de rest van de cellen werden cellijnen gestart in 30 mL MSMO met vancomycine
(Vm), carbenicilline (Cb) (deze doden bacteriën) en kanamycine(Km) (doodt de niet-
97
Deel 4: Resultaten en discussie
getransformeerde plantencellen). De cellen werden opgegroeid in erlenmeyers en het medium
werd wekelijks ververst (43 ml MSMO met Km + 7 ml celcultuur).
4.1.3. Expressie analyse
De plantencellen werden geoogst door filtratie van een 2 dagen oude cultuur op een glasfilter
en ingevroren bij -80oC. Uit de geoogste cellen werd eiwitextract bereid (zie paragraaf 3.6.1.),
en daarna werd via Bradford de eiwitconcentratie bepaald (zie paragraaf 3.6.1.1.). Dit werd
per construct in duplo uitgevoerd en uit de twee bekomen waarden werd het gemiddelde
berekend. Met BSA werd een ijklijn opgesteld die de hoeveelheid eiwit uitdrukt in g / l en
die toelaat de concentratie van eiwitextracten nauwkeurig te bepalen.
Bij 100 l eiwitextract werd 25 l (5x) sample buffer aan de eiwitten toegevoegd, dit gaf een
totaalvolume van 125 l met 1x sample buffer. Via SDS-PAGE (zie paragraaf 3.6.2.) werden
de eiwitten vervolgens gescheiden volgens grootte.
Er werd telkens 60 g eiwit per laantje geladen.
Berekening: bv. voor het construct Pcdkb1;1::CDKB1;1intron-TAP mix2
Eiwitconcentratie: 10,9 g / l
Men laadt:
60 g eiwit

(60 g / 10,9 g / l) x 1,25 = 6,8 l laden
Na SDS-PAGE werden de eiwitten getransfereerd op een PVDF-membraan via ‘wet Western
blotting’ (zie paragraaf 3.6.3.), en vervolgens werden de eiwitten gedetecteerd via
immunodetectie (ECL) (zie paragraaf 3.6.4.1.).
Als primair antilichaam (AL) werd in eerste instantie anti-CBP (rabbit, 1/1000) gebruikt. Dit
AL bindt het calmoduline binding peptide van de TAP-tag. Hierna werd het secundair AL,
anti-rabbit geconjugeerd met Horse Radish Peroxidase (HRP, 1/10.000), toegevoegd. Het
secundaire AL bindt op het primaire AL. Op deze manier werd het geTAP-tagged eiwit
gevisualiseerd. Naast de eiwitextracten van de transgene lijnen met het TAP-construct met
introns, werd ook extract geladen van de lijnen met het TAP-construct met enkel de
coderende sequentie zonder de introns (cDNA). Als negatieve controle werd een wild type
eiwitextract geladen (Figuur 4.19).
98
Deel 4: Resultaten en discussie
CDKA
WT
- intron
CDKA
CDKA
CDKA
+ intron
+ intron
+ intron
CDKB
- intron
CDKB
CDKB
CDKB
+ intron
+ intron
+ intron
75 kDa
50 kDa
37 kDa
3 onafhankelijke lijnen
3 onafhankelijke lijnen
Fig. 4.19: Analyse van transgene expressie via Western blot in transgene culturen getransformeerd met CDKA;1
(met en zonder intron) en CDKB1;1 (met en zonder intron)
Negatieve controle: Wild type (WT).
In elke laan werd 60g eiwit gescheiden.
De grootte van CDKA;1 is 34 kDa, die van de TAP-tag is 20 kDa, dus verwacht men een
bandje bij 54 kDa voor het transgene eiwit. In het laantje met de negatieve controle (WT) is er
geen bandje ter hoogte van 54 kDA, maar in de lanen 2 t.e.m 5 wel, dus hier vindt men zoals
verwacht CDKA;1-TAP (rode pijl) terug. Er is geen verschil in intensiteit tussen CDKA;1TAP en CDKA;1_intron-TAP (Figuur 4.19).
De grootte van CDKB1;1 is 35,3 kDa, dus die van het transgene eiwit is 55,3 kDa. Na
vergelijking met het wild type extract ziet men dat het CDKB1;1-TAP (blauwe pijl) met en
zonder de introns slechts zeer laag tot expressie komt onder controle van de endogene
promotor. Ook hier geen detecteerbaar verschil tussen de constructen met en zonder intron
(Figuur 4.19).
Om ook een vergelijking te kunnen doen met het endogene CDKA;1, werd bij de volgende
expressie-analyse rabbit anti-cdc2a ((1/1000) bindt op CDKA;1) als primair AL en anti-rabbit
HRP (1/10.000) als secundair AL gebruikt. Dit laat dus detectie toe van zowel het endogene
als het geTAP-tagged CDKA;1.
1
50 kDa
2
3
4
5
1: Pcdka1:CDKA-gs-TAP
2: Pcdka1:CDKA-Intron-TAP
37 kDa
3: Pcdka1:CDKA-Intron-TAP
4: Pcdka1:CDKA-Intron-TAP
5: Negatieve controle: Wild type
25 kDa
Fig. 4.20: Analyse van transgenexpressie via Western
blot in transgene culturen getransformeerd met
CDKA (met en zonder intron). Van alle extracten
werd 60g eiwit geladen.
99
Deel 4: Resultaten en discussie
Er is in alle lanen een duidelijke band rond 34 kDa van het endogene CDKA;1. Het geTAPtagged CDKA;1 wordt in alle lanen teruggevonden op de verwachte grootte van 54 kDa
(laan1-4) en is afwezig in de negatieve controle (laan 5). Ook met het antilichaam tegen
CDKA;1 is het duidelijk dat toevoeging van de endogene introns niet leidt tot een verhoging
in eiwit-accumulatie. Wanneer we het niveau van het fusie-eiwit vergelijken met het
endogene CDKA;1 niveau, zien we dus duidelijk dat het endogene niveau van expressie niet
bereikt kan worden (Figuur 4.20). Om in competitie te treden met het endogene eiwit voor
opname in een eiwitcomplex is dit echter essentieel. Want hoe hoger de expressie van het
geTAP-tagged eiwit, hoe groter de competitie met het endogene eiwit en hoe meer
eiwitcomplexen er bijgevolg gezuiverd kunnen worden. Overexpressie biedt hier een
oplossing, maar wordt liefst vermeden, daar dit leidt tot een artificiële situatie, waarin het
moeilijker is om gedetecteerde eiwitinteracties te evalueren. Zo is het moeilijk om een
onderscheid te maken tussen bona fide interacties en interacties als gevolg van de
overexpressie.
Ook voor CDKB1;1 werd de expressie-analyse herhaald met anti-cdc2b ((1/2500) bindt op
CDKB1;1) als primair AL en anti-rabbit HRP(1/10.000) als secundair AL.
1
2
3
4
5
1: Negatieve controle: Wild type, hiervan
werd 10 l geladen = 60g eiwit
50 kDa
2: Pcdkb::CDKB1;1-TAP
37 kDa
3: Pcdkb::CDKB1;1intron-TAP
4: Pcdkb::CDKB1;1intron-TAP
25 kDa
5: Pcdkb::CDKB1;1intron-TAP
Fig. 4.21: Analyse van transgenexpressie via
Western
blot
in
transgene
culturen
getransformeerd met CDKB1;1 (met en zonder
intron). Van alle extracten werd 60g eiwit
geladen
Ook nu was er geen verschil in eiwit-accumulatie (met of zonder introns) merkbaar (Figuur
4.21).
Onder controle van de constitutieve promotor CaMV 35S en in de afwezigheid van introns
blijken beide eiwitten echter hoger te accumuleren dan de endogene eiwitten. Men zou hieruit
kunnen afleiden dat de gebruikte regulatorische sequenties met introns niet alle cisregulatorische sequenties bevatten die de endogene genen wel hebben. Als endogene
promotor werd voor CDKA;1 1662 basen en voor CDKB1;1 494 basen stroomopwaarts van
100
Deel 4: Resultaten en discussie
het startcodon gekozen. Enhancer sequenties bevinden zich echter dikwijls enkele kilobasen
stroomop- of stroomafwaarts en zijn dus niet opgenomen in ons construct. Een andere
mogelijke verklaring is dat het verschil in accumulatie tussen endogeen CDK en recombinant
CDK-tag gelegen is aan een verschil in gendosage tussen het endogene gen (8C = 8 kopijen)
en het transgen, en dat het toevoegen van introns geen verschil maakt in transgenexpressie.
Er moet ook rekening gehouden worden met het feit dat ‘intron mediated enhancement’(zie
paragraaf 1.4.) naar alle waarschijnlijkheid een genafhankelijk proces is. Onze observaties bij
CDKA;1intron-TAP en CDKB1;1intron-TAP gelden niet per sé voor alle andere genen in
Arabidopsis.
101
Deel 4: Resultaten en discussie
4.2. Silencing d.m.v. RNAi
Een tweede manier om een hogere verhouding van transgene expressie/endogene expressie te
bekomen is het specifiek silencen van de endogene expressie van het eiwit in kwestie d.m.v.
RNA-geïnduceerde gene silencing (dit zorgt enkel voor een ‘knock-down’ en niet voor een
‘knock-out’). We hebben deze methode getest op CDKA;1 via transformatie met een RNAiconstruct gericht tegen het 3’UTR (untranslated region) van het endogene gen. Het transgen
dat codeert voor het CDKA;1-TAP bevat immers een andere 3’UTR (de 35S transcriptie
terminator), waardoor de onderdrukking van genexpressie specifiek gericht kan zijn tegen
endogeen CDKA;1. Twee RNAi-hairpinconstructen werden gemaakt met het 3’UTR (sense
en anti-sense) van CDKA;1 en supergetransformeerd in transgene celculturen die CDKA;1TAP tot expressie brengen onder controle van de endogene CDKA;1-promoter en onder
controle van de constitutieve 35S promotor.
4.2.1. Kloneringsstrategie
4.2.1.1. Adaptor-PCR
Via adaptor-PCR met attB bevattende primers werd het 3’UTR van CDKA;1 opgepikt. Als
template werd genomisch DNA (10ng en 50ng) genomen. Naast het sense 3’UTR werd
eveneens het antisense 3’UTR opgepikt. Op agarosegel werden alle fragmenten
teruggevonden (Figuren 4.22 en 4.23).
M
1
2
M: Smartladder
1: 1 l (10 ng) genomisch
DNA gebruikt.
2: 5 l (50 ng) genomisch
DNA gebruikt
600 bp
600 bp
400 bp
400 bp
200 bp
Fig. 4.22: Analyse van de adaptor-PCR
Fig. 4.23: Aanalyse van de adaptor-PCR
(attB1-3’UTR-sense-CDKA;1-attB2)
(attB1-3’UTR-antisense-CDKA;1-attB2)
via
agarosegelelektroforese. Er werd telkens 18
via agarosegelelektroforese.
l PCR product met 2 l ladingsbuffer
geladen.
.
102
Deel 4: Resultaten en discussie
4.2.1.2. BP-recombinatie reactie
Er werd een BP-recombinatie reactie uitgevoerd tussen het PCR-product attB1-3’UTR senseCDKA;1- attB2 en de pDonr207 vector (met gentamycine resistentiegen) met vorming van
een entry vector, pEntryL1L2-3’UTR sense-CDKA;1.
PCR produkt
AttB1
3’ UTR
AttB 2
AttL1
3’ UTR
AttL1
BP
ccdB gen
AttP1
AttP2
pDonr 207
pEntryL1 L2 -3’ UTR
sense--CDKA;1
sense
Reactie
Gm
Gm
Gm
De gevormde Entry-vectoren (Figuur 4.24) werden vervolgens getransformeerd naar E. coli
DH5 en uitgeplaat op LB+ met gentamycine (Gm).
Miniprep plasmide DNA bereidingen werden uitgevoerd op 10 kolonies en deze werden
getest via een controle restrictiedigest met HindIII en EcoRV. De verwachte fragmenten van
1077 bp en 2640 bp werden teruggevonden (Figuur 4.25).
Hin dIII (3536)
a ttL2
3'UTR CDKA;1
a ttL1
pEntry 3`UTR CDKA;1 (sense)
3718 bp
Eco RV (896)
Gm (R)
Fig. 4.24 : pEntryL1L2-3’UTR senseCDKA;1
P c prom ote r
103
Deel 4: Resultaten en discussie
M
1
2
3
4
5
6
7
8
9
10
M
3000 bp
1000 bp
Fig. 4.25: Analyse van het restrictiemengsel op agarosegel Het restrictiemengsel (20 l + 2 l
ladingsbuffer) werd op gel geladen en alle 10 kolonies hebben de juiste grootte.
M: 2 l Smartladder
De 10 klonen werden vervolgens verder gecontroleerd via sequenering. Kloon 6 bevatte geen
mutaties en werd gebruikt om mee verder te werken. Van deze kloon werd een midiprep
plasmide DNA bereiding gedaan en de DNA concentratie werd bepaald.
Voor het antisense-construct werd dezelfde werkwijze gehanteerd met een positief resultaat
als gevolg (resultaten niet weergegeven).
4.2.1.3. LR-recombinatie reactie
Via een dubbele LR-recombinatie reactie tussen pEntryL1L2-3’UTR sense-CDKA;1 en
pAgrikola werd het expressieplasmide pAgrikola_3’UTR sense-CDKA;1 geconstrueerd
(Figuur 4.29).
3’UTR
ccdB
PCR product
Gateway
BP cloning
ccdB
entry clone
ccdB
+
intron
ccdB
promoter
ter
35S or inducible
Gateway
double
LR cloning
intron
hpRNA vector
unspliced
spliced
predicted
hpRNA
structure
Fig. 4.29: Een overzicht van de gevolgde LR kloneringsstrategie.
104
Deel 4: Resultaten en discussie
Na transformatie van de LR-reactie naar E. coli DH5α werd er geselecteerd op LB+ Km en
van 5 kolonies werd via een miniprep plasmide DNA bereid. Expressievectoren werden
gecontroleerd via een restrictiedigest. Er werd geknipt met HindIII, de verwachte fragmenten
waren 6712 bp, 209 bp, 205 bp, 1015 bp en 1606 bp groot, deze werden teruggevonden bij
analyse op agarosegel (Figuur 4.26).
M
1
2
3
4
5
Fig. 4.26: Controle restrictiedigest op agarose gel
6000 bp
gebracht.
1500 bp
1000 bp
400 bp
200 bp
Van kloon1 werd plasmide DNA bereid via een midi prep.
Ook de Entry-vector met het antisense construct werd op een gelijkaardige manier gebruikt in
een dubbele LR-recombinatie reactie om de expressievector pAgrikola_3’UTRantisenseCDKA;1 te construeren. Deze werd gecontroleerd via een restrictiedigest. Er werd geknipt
met HindIII. De verwachte fragmenten van 6712 bp, 209 bp, 205 bp, 1015 bp en 1606 bp
groot, werden teruggevonden. Klonen 1 tot en met 7 bevatten de verwachte fragmenten, kloon
8 niet (Figuur 4.27).
M
1
2
3
4
5
6
7
8
Fig. 4.27: Controle restrictiedigest op agarose gel
gebracht.
6000 bp
1500 bp
1000 bp
200 bp
105
Deel 4: Resultaten en discussie
4.2.2. Supertransformatie naar transgene CDKA;1-TAP lijnen
4.2.2.1. Transformatie naar Agrobacterium tumefaciens
Via elektroporatie werden beide expressievectoren getransformeerd naar Agrobacterium
tumefaciens C58C1 RifR pMP90.
4.2.2.2. Supertransformatie
De agrobacteria met constructen pAgrikola_3’UTRsense-CDKA;1 en pAgrikola_3’UTR
antisense-CDKA;1 werden via co-cultivatie gemengd met enerzijds een transgene lijn die het
CDKA;1-TAP tot overexpressie brengt en anderzijds een transgene lijn waar het CDKA;1TAP onder controle staat van de endogene promotor.
Na de co-cultivatie werd de mix direct in cultuur gebracht zonder wegwassen van de agro’s en
zonder uitplaten. Naast de agro-afdodende antibiotica Cb en Vm, werd voor selectie van
supertransformanten enerzijds Km (voor selectie van het TAP-construct) en Basta (voor
selectie van het hairpin RNAi-construct) gebruikt en anderzijds enkel Basta. Het gebruik van
4 antibiotica gaf een te hoge selectieve druk en met deze strategie konden geen transgene
culturen bekomen worden. Dit lukte wel met enkel de Basta-selectie, voor supertransformatie
in de transgene lijn met de endogene promotor althans. Met de transgene lijn die het TAPconstruct tot overexpressie brengt, konden geen supertransformanten bekomen worden.
Celmateriaal van de Pend::CDKA;1-TAP X pAgrikola-3’UTR_CDKA;1 transgene lijnen met
het sense en antisens 3’UTR werden geoogst en bewaard bij -80oC voor verdere
expressieanalyse.
106
Deel 4: Resultaten en discussie
4.2.3. Expressie analyse
Van het ingevroren celmateriaal werd een eiwitextract gemaakt en 60 µg werd geanalyseerd
via SDS-PAGE en western blotting. Als controle werd een gelijke hoeveelheid wild type
extract en Pend::CDKA;1(intron)-TAP extract op gel geladen. De Western blot werd
geïncubeerd met -cdc2a (primair AL, 1/2500) en -rabbit HRP (secundair AL, 1/10.000),
hierdoor werden het endogene en transgene CDKA;1 zichtbaar.
1
2
3
4
5
75
50
CDKA;1-TAP
37
endogeen CDKA;1
25
Fig. 4.28:
Analyse van transgenexpressie via Western blot in transgene culturen Pend::CDKA;1-TAP
supergetransformeerd met pAgrikola-3’UTR_CDKA;1 (sense en antisens 3’UTR).
1. Wild type (60 µg)
2. PA::CDKA;1-TAP (60 µg)
3. PA::CDKA;1intron-TAP (60 µg)
4. PA::CDKA;1-TAP + pAgrikola-3’UTRcdka;1 sense (60 µg)
5. PA::CDKA;1-TAP + pAgrikola-3’UTRcdka;1 anti-sense (60 µg)
Na immunodetectie met een polyklonaal antilichaam dat CDKA;1 herkent, werd duidelijk dat
er een significante daling was in de endogene CDKA;1-niveaus met het silencing-construct
(Figuur 4.28, laan 4 en 5). Er werd eerst gevreesd dat het transgene CDKA;1 ook ‘down’
gereguleerd zou zijn door een mechanisme van transitieve silencing, daar zowel het hairpinconstruct als het TAP-construct att-sites bevatten. Door vergelijking van de CDKA;1-TAP
band, zien we dat dit fenomeen niet opgetreden is. De lagere intensiteit van het endogene
CDKA;1 signaal in laan 4 en 5, is niet te wijten aan verschillende hoeveelheden geladen
eiwit, daar de cross-reactie banden rond 75 kDa, een gelijkaardige intensiteit hebben (Figuur
4.28).
107
Deel 4: Resultaten en discussie
Om deze ‘knock down’ van endogeen CDKA;1 in een celsuspensiecultuur verder te
bevestigen, werd de analyse herhaald, maar nu met verschillende verdunningen van de stalen
(60 µg, 30 µg, 15 µg en 7.5 µg).
1
2
3
4
5
6
7
8
75
50
CDKA;1-TAP
37
endogeen CDKA;1
25
Gereduceerde endogene CDKA;1 niveau’s
Fig. 4.29: Analyse van transgenexpressie via Western blot in transgene culturen Pend::CDKA;1TAP supergetransformeerd met pAgrikola-3’UTR_CDKA;1 (sense en antisens 3’UTR).
1: PSB-d, wild type cellen (15 µg )
2: PSB-d, wild type cellen (7,5 µg)
3: pA:CDKA;1-TAP (15 µg)
4: pA:CDKA;1-TAP (7,5 µg)
5: pAgrikola_3’UTR sense-CDKA;1 (15 µg)
6: pAgrikola_3’UTR sense-CDKA;1 (7,5 µg)
7: pAgrikola_3’UTR anti-sense-CDKA;1 (15 µg)
8: pAgrikola_3’UTR anti-sense-CDKA;1 (7,5 µg)
De immunoblot met de 2 laagste verdunningen bevestigt duidelijk het vorige resultaat. Het
endogene CDKA;1 accumuleert veel lager in de lijnen met het hairpin-construct. Daar
CDKA;1 een essentieel eiwit is, is het logisch dat er toch een minimaal basaal niveau van
CDKA;1 behouden blijft, opdat de cellen zouden kunnen blijven delen. De niveaus van het
transgene CDKA;1 zijn waarschijnlijk te laag om volledig de functie van het endogene
CDKA;1 over te nemen (Figuur 4.29).
Er is geen verschil waarneembaar in silencing efficiëntie wanneer het sense-constuct
vergeleken wordt met het antisense-construct. Daar het sense 3’UTR signalen bevat voor
RNA-processing zoals een poly-adenylatie signaal, werd gevreesd dat het hairpin RNA reeds
geprocessed zou zijn voordat de hairpin gevormd zou zijn. Aangezien er met het senseconstruct echter ook silencing optreedt, was deze vrees echter ongegrond.
108
Deel 4: Resultaten en discussie
Deze 2 culturen zullen verder opgeschaald worden, zodat er voldoende materiaal voor handen
is voor een TAP-zuivering en een vergelijking met een TAP-zuivering op de oorspronkelijke
cultuur zonder RNAi-construct. Door de verlaagde endogene CDKA;1 niveaus, kan er nu
meer competitie zijn tussen het endogene en het transgene eiwit voor inbouw in een
eiwitcomplex, met als gevolg dat meer complexen gezuiverd kunnen worden.
Een interessant toekomstperspectief is het creëren van een nieuwe expressievector die zowel
het RNAi-construct als het TAP-construct bevat binnen hetzelfde T-DNA.
109
Deel 4: Resultaten en discussie
4.3. C-terminale versus N-terminale tagging
Soms zal de toevoeging van een C-terminale tag aan een eiwit diens functie verhinderen of de
inbouw in complexen onmogelijk maken of significant verminderen. Een simpel alternatief is
het toevoegen van de tag aan de amino-terminus van het doelwitproteïne. Toevoeging van een
tag kan ertoe leiden dat sommige domeinen gemaskeerd worden en bijgevolg kan dit leiden
tot het uitblijven van bepaalde eiwit-interacties. Het is dus mogelijk dat er verschillende
interactoren opgepikt zijn als N-terminale versus C-terminale TAP-tagging vergeleken wordt.
In deze thesis werden er voor CDKA;1, CDKB1;1, CKS1 en CycD3;1 N-terminale TAPconstructen gemaakt. Voor de C-terminale tag-fusies werden reeds complexen gezuiverd.
Door een vergelijking van de complexen die gezuiverd werden met een C- versus Nterminaal getagde bait, kan er vervolgens geëvalueerd worden welke methode de beste
resultaten oplevert voor typische celcycluseiwitten.
4.3.1. Kloneringstrategie
De entry-vectoren, pEntryL1 L2-orf (+ stopcodon), met CDKA;1_intron, CDKB1;1_intron,
CKS1_intron en CycD3;1_intron werden gemaakt met stopcodon en gecontroleerd via
sequenering (zie puntje 4.1.1.2.1 ).
4.3.1.1. Klonering van de 35S promotor in pDonrP4P3
Er werd eerst een adaptor-PCR reactie uitgevoerd om de CaMV 35S promotor op te pikken en
te flankeren met attB4- en attB3-sites. Hiervoor werden de attB4-PacI primer en de attB3AscI primer gebruikt. Als template werd het pEntryL4R1-P35S plasmide genomen. De 2
restrictiesites werden toegevoegd om eventueel de promotor klassiek te gaan kloneren in de
N-terminale destination vector, indien de BP-reactie niet zou lukken.
PacI
attB4
P35S
attB3
PCR
AscI
P35S
PacI
attB4
AscI
attB3
110
Deel 4: Resultaten en discussie
Resterend template na PCR
1500 bp
1000 bp
PacI-attB4-P35S-attB3-AscI

Resterende primers na PCR
Fig. 4.30: Analyse van de PCR-amplificatie van de 35S promoter op agarosegel
Het PCR-product, PacI-attB4-P35S-attB3-AscI, werd op agarose gel gebracht. Zoals
verwacht werd het fragment rond de 1200 bp teruggevonden (Figuur 4.30).
Daar ongebruikte attB-bevattende primers kunnen interfereren tijdens de BP-reactie, werd het
PCR-product eerst gezuiverd m.b.v. een Chromaspin 1000 kolom.
Vervolgens werd de BP-recombinatie reactie tussen pDonrP4P3 en attB4-P35S-attB3
uitgevoerd, resulterend in de entry-vector, pEntryL4L3-P35S. De entry-vector werd
getransformeerd naar E. coli DH 5 en uitgeplaat op LB+ met Km.
Ter controle werd een kolonie PCR uitgevoerd met de primers attB4-P35S-fwd en attB3P35S-rev op 10 kolonies met vector pEntryL4L3-P35S . Dit werd gecontroleerd op agarosegel,
de verwachte fragmenten werden teruggevonden rond 1200 bp, behalve bij klonen 1 en 10
(Figuur 4.31).
M
1
2
3
4
5
6
7
8
9
10
M
1500 bp
1000 bp
Resterende primers
Fig. 4.31: Analyse van het kolonie PCR-product van de 10 kolonies agarose gel.
Een miniprep plasmide DNA bereiding van pEntryL4L3-P35S werd uitgevoerd.
111
Deel 4: Resultaten en discussie
Als tweede controle werd een restrictiedigest met EcoRV en SacI gedaan. De verwachte
fragmenten waren 24 bp, 151 bp, 172 bp, 197 bp, 865 bp en 2353 bp groot. Het restrictie
mengsel werd op agarose gel gebracht. Alle fragmenten werden teruggevonden, enkel die van
24 bp is niet zichtbaar (Figuur 4.32).
2500 bp
800 bp
200 bp
Fig. 4.32: : Analyse van de restrictiedigest op agarosegel.
Alle 10 de klonen werden verder gecontroleerd via sequenering.
4.3.1.2. De LR- recombinatie reactie voor N-TAP fusies
Een LR-recombinatie reactie met de vectoren pKNTAP, pEntryL4 L3-P35S en pEntryL1L2-orf
(+stopcodon), met CDKA;1_intron, CDKB1;1_intron, CKS1_intron en CycD3;1_intron werd
uitgevoerd (Figuur 4.33), met vorming van een N-terminale TAP-expressievector pKNTAP35S::NTAP-orf (+introns en stopcodon).
L3
L4
L1
L2
promotor
gene
pEntry-prom.
pEntry-gene
NTAP
CcdB Cm
R4
CcdB Cm
R3
R1
R2
pKNTAP
promotor NTAP
gene
pExpression-NTAP
Fig. 4.33: De LR-recombinatie reactie waarbij de twee CcdB genen op pKNTAP vervangen worden door een promoter
enerzijds en het gen van interesse anderzijds, resulterend in een N-terminale TAP-expressievector.
112
Deel 4: Resultaten en discussie
Het LR-reactiemengsel werd getransformeerd naar E. coli DH5 en uitgeplaat op LB+ met
Sp. Een miniprep plasmide DNA bereiding van onze klonen werd uitgevoerd en
gecontroleerd d.m.v. restrictiedigest.
M
CDKA;1-Intron
CKS1-Intron
CDKB1;1-Intron
Cyc D3;1
10000 bp
10000 bp
2500 bp
2000 bp
1000 bp
2000 bp
800 bp
600 bp
600 bp
200 bp
Fig. 4.34: Controle restrictiedigest op agarosegel gebracht
De controle restrictiedigest werd gedaan van:
pKNTAP-P35S::CDKA;1-Intron met XbaI en XhoI, de verwachte fragmenten waren 8347 bp,
2188 bp, 1781 bp, 1388 bp en 218 bp.
pKNTAP-P35S::CKS1-Intron met EcoRV, de verwachte fragmenten waren 10980 bp, 1327
bp en 197 bp.
pKNTAP-P35S::CycD3;1-Intron met XbaI en XhoI, de verwachte fragmenten waren 8347 bp,
2471 bp, 1781 bp, 495 bp en 171 bp.
pKNTAP-P35S::CDKB1;1-Intron met SacI, de verwachte fragmenten waren 9413 bp, 2278
bp, 863 bp en 678 bp.
De verwachte fragmenten werden alle teruggevonden op de agarose gel (Figuur 4.34).
Vervolgens werd er een midiprep plasmide DNA bereiding van de klonen uitgevoerd en de
concentratie werd bepaald. Via elektroporatie werden de goede klonen getransformeerd naar
Agrobacterium tumefaciens.
4.3.2. Transformatie naar PSB-d plantencellen
De agrobacteria met onze N-terminale expressievectoren, werden getransformeerd naar PSBd
cellen via co-cultivatie en getransformeerde cellen werden in cultuur gebracht, zoals voorheen
reeds beschreven (4.1.2).
113
Deel 4: Resultaten en discussie
4.3.3. Expressie analyse
Eiwitextract werd bereid en 60 µg werd geladen. De eiwitten werden gescheiden via SDSPAGE, en transgeen eiwit werd gedetecteerd via immunodetectie na western blotting met als
primair AL rabbit anti-CBP, wat bindt op het calmoduline binding peptide van de TAP-tag.
Hierna werd het secundair AL, anti-rabbit geconjugeerd met Horse Radish Peroxidase (HRP),
toegevoegd. Als negatieve controle werd wild type extract geladen.
WT
1
2
3
4
5
6
7
8
75 kDa
50 kDa
37 kDa
25 kDa
10 kDa
50 kDa
35S:NTAP-CDKA;1 (intron)
35S:NTAP-CDKB1;1 (intron)
Fig. 4.35: Western blot analyse van 35S:NTAP-CDKA;1 (intron) en 35S:NTAP-CDKB1;1 (intron).
Boven:
WT: Wild type PSB-d cellen.
1 t.e.m 3: 35S:NTAP-CDKA;1 (intron)
4 t.e.m 8: 35S:NTAP-CDKB1;1 (intron)
Onder: Dezelfde blot, maar met een kortere belichting (5s)
Men ziet een zeer intense band ter hoogte van de N-TAP fusie-eiwitten, bij 54 kDa voor
NTAP-CDKA;1 en bij 55,33 kDa voor NTAP-CDKB1;1 (Figuur 4.35).
114
Deel 4: Resultaten en discussie
Voor NTAP-CKS1-Intron werd voor immunodetectie als primair AL anti-CKS (1/1000)
gebruikt. Op de blot werd dus naast het transgene CKS1, ook het endogene CKS1
gevisualiseerd. Het transgeen CKS1 accumuleert dus veel hoger dan het endogene CKS1.
Het CKS1 eiwit is 10,5 kDa groot (zie rode pijl) en de tag is 20 kDa groot. Ter hoogte van de
30,5 kDa ziet men de intense band van 35S:NTAP-CKS1, deze ontbreekt bij het WT (PSB-d)
(Figuur.4.36)
PSB-d
35S:NTAP-CKS1-Intron
Fig. 4.36: Western blot met het construct 35S:NTAP-CKS1-intron.
50 kDa
37 kDa
25 kDa
20 kDa
10 kDa
PSB-d
35S:NTAP-CycD3;1 intron
100 kDa
75 kDa
Fig. 4.37: Western blot met het construct 35S:NTAP-CycD3;1-intron
50 kDa
(62,8 kDa).
37 kDa
25 kDa
20 kDa
10 kDa
Voor NTAP-CycD3;1-Intron werd voor immunodetectie als primair AL anti-CBP (1/1000)
gebruikt. Ter hoogte van 62,8 kDa (het CycD3;1 eiwit is 42,8 kDa groot en de tag is 20 kDa
groot. ) verwacht men in vergelijking met het WT een extra bandje, maar dit is niet het geval.
Een mogelijke verklaring is dat het bandje van het fusie eiwit gemaskeerd werd door de crossreactie banden op die hoogte.
115
Deel 4: Resultaten en discussie
Ter hoogte van 85 kDa (rode pijl) ziet men echter wel een differentiële band die niet aanwezig
is bij het WT, dit kan ook het fusie-eiwit zijn. Soms gebeurt het dat de eiwitten trager
migreren doorheen de gel en men ze terugvindt op een hogere positie dan de theoretisch
verwachte (Figuur 4.37).
Ter hoogte van 32 kDa (blauwe pijl) ziet men een differentiële band, die niet aanwezig is bij
het WT, dit kan een degradatieband van het fusie-eiwit zijn, aangezien CycD3;1 een zeer
onstabiel eiwit is (Figuur 4.37).
116
Deel 4: Resultaten en discussie
4.3.4. Tandem Affinity Purification
De transgene cellijnen met een goede expressie werden vervolgens opgeschaald tot 10 L
celcultuur en het celmateriaal werd uiteindelijk geoogst. Wegens contaminatie werd er geen
materiaal geoogst voor de 35S::NTAP-CDKA;1 transgene lijn.
Oogst: 10 L celcultuur met 35S::NTAP_CKS1_intron geeft 46,55 g celmateriaal
10 L celcultuur met 35S::NTAP_Cyc D3;1_intron geeft 55,25 g celmateriaal
10 L celcultuur met 35S::NTAP_CDKB1;1_intron geeft 50,34 g celmateriaal
Het TAP protocol, zoals beschreven in materiaal en methoden (paragraaf 3.6.5.), werd
gebruikt om eiwitcomplexen te zuiveren uit celmateriaal van NTAP-CDKB1;1, NTAP-CKS1
en NTAP-CycD3;1. Elke zuivering werd in duplo uitgevoerd. Gezuiverde eiwitcomplexen
werden geconcentreerd via TCA-precipitatie. Vervolgens werd het precipitaat opgekookt in
NuPAGE sample buffer en geladen op 4-12% gradiënt NuPAGE gels. Eiwitten werden
gevisualiseerd via Coőmassie G kleuring.
M
35S::NTAP-CDKB1;1-Intron
35S::NTAP-CKS1-Intron
M
kDa
kDa
188
188
98
98
62
35S::NTAP-CycD3;1-Intron
62
49
49
38
38
28
28
17
17
14
14
6
6
3
3
Fig. 4.38: 4-12% gradiënt NuPAGE gels gekleurd met Coőmassie G
117
Deel 4: Resultaten en discussie
De gels werden opgestuurd naar het CEPROMA (Centrum voor proteoomanalyse en massa
spectrometrie aan de UA), waar de eiwitten geϊdentificeerd werden via MALDI-TOFTOF.
Deze resultaten zijn spijtig genoeg nog niet binnen, maar zullen wel besproken worden tijdens
de scriptievoorstelling en toegevoegd worden als addendum aan de thesis.
Wanneer we de coomassies vergelijken van de TAP-eluaten van C-terminaal en N-terminaal
getagged CKS1, worden verschillen waargenomen (Figuur 4.39).
1
2
188 kDa
188 kDa
98 kDa
98 kDa
62 kDa
1.
2.
TAP-eluaat 35S::CKS1-TAP
TAP-eluaat 35S::NTAP-CKS1
62 kDa
49 kDa
49 kDa
38 kDa
38 kDa
28 kDa
28 kDa
17 kDa
14 kDa
Fig. 4.39: Vgl. TAP-eluaten C- en N- terminaal
17 kDa
14 kDa
6 kDa
6 kDa
Ten eerste zien we een veel intensere band ter hoogte van het TEV-verknipte CKS1 fusieeiwit bij de N-terminale TAP-zuivering (Figuur 4.39). Een mogelijke verklaring is dat de
NTAP-tag in de expressievector regulatorische elementen zoals introns en extra ribosoom
bindende plaatsen bevat in tegenstelling tot de TAP-tag in de C-terminale expressievectoren,
waardoor er in het totaal eiwit-extract reeds voor de zuivering veel meer transgeen eiwit
aanwezig is. Finaal wordt er dus ook meer CKS1 gezuiverd. Verder nemen we ook een
verschillend bandenpatroon waar tussen de 2 eluaten (Figuur 4.39). Om deze verschillen
verder te evalueren en na te gaan of meer of andere complexen werden gezuiverd met Nterminale fusie in vergelijking met C-terminale, is MS-analyse noodzakelijk. Wegens
tijdsgebrek konden de resultaten van de MS-analyse hier niet meer opgenomen. Ze zullen
later als addendum toegevoegd worden.
118
Deel 5: Samenvatting
Deel 5: Samenvatting
Met het volledig sequeneren van verschillende genomen (bv. het Arabidopsis thaliana
genoom) heeft er zich een nieuwe uitdaging aangediend, namelijk het ontcijferen van de
relaties tussen de individuele genen en het begrijpen van de moleculaire organisatie van
cellulaire netwerken.
Eiwitinteracties zijn essentieel voor het leven van een cel, de analyse van zulke interacties laat
wetenschappers toe de functie van ongekarakteriseerde proteïnen en de genen die ervoor
coderen te bepalen.
Verschillende methodes zijn er doorheen de jaren ontwikkeld om eiwit-eiwit interacties te
onderzoeken. In de Functionele Proteoom-analyse groep bestudeert men de celcyclus eiwiteiwit interacties van Arabidopsis thaliana m.b.v. tandem affiniteitszuivering (TAP).
TAP is een fysische methode waarbij een eiwit wordt gefusioneerd, C- of N-terminaal, met
een TAP-tag. Deze tag bestaat uit een Calmoduline bindend peptide (CBP), een TEV
(Tobacco Etch Virus)-protease klievingssplaats en twee IgG (Immunoglobuline G) bindende
domeinen (ZZ domein) van het Staphylococcus aureus proteïneA, kortom de CBP-TEV-ZZ
TAP-tag genoemd. Dit TAP-tagged eiwit wordt tot expressie gebracht in PSB-d celsuspensie
culturen, afgeleid van Arabidopsis thaliana ecotype Landsberg erecta, en zal in competitie
treden met het endogene eiwit om ingebouwd te worden in eiwitcomplexen. Het TAPcomplex wordt uit de cellen geïsoleerd via 2 affiniteitstappen. Namelijk affiniteitselectie op
een IgG sepharose-matrix, waarop de proteïneA-tag zal binden. Na het wegwassen van
contaminanten met buffers die de fysiologische condities van de cel nabootsen, voegt men
TEV-protease toe om het gebonden materiaal vrij te stellen, het eluens wordt in de tweede
affiniteitsstap in aanwezigheid van calcium ionen geïncubeerd met agarose parels die een
calmoduline mantel bevatten, deze zullen binden met het Calmoduline Bindend Peptide (de
CBP-tag ) op de resterende TAP-tag cassette, na het wassen wordt het gebonden materiaal
vrijgesteld met EGTA. De eiwitcomplexen in het extract worden gescheiden via PAGE, de
bandjes van interesse worden uit de gel gesneden en onderworpen aan een trypsine digest. De
bekomen peptiden worden via massaspectrometrie gedeeltelijk gesequeneerd. De proteïne
wordt via eiwitsequentie databanken geïdentificeerd.
In deze thesis werden cycline afhankelijke kinasen (CDKA;1 en CDKB1;1), cyclineD3;1 en
CDK subunit 1 (CKS1) onderzocht die, in complex met andere eiwitten, uit PSB-d cel
suspensie culturen werden gezuiverd. Deze cellen hebben een 8C–DNA inhoud, d.w.z dat
119
Deel 5: Samenvatting
elke gen in meerdere kopijen (8) voorkomt en de competitie met het endogene eiwit dus zeer
groot is, wat overexpressie dikwijls noodzakelijk maakt.
Er werd getracht de expressie van het endogene eiwit te verlagen en die van het transgene
fusie eiwit te verhogen om zo meer fusie-eiwit gebonden complexen te kunnen vergaren.
Door de introns op te nemen in de chimere genen in de expressievectoren, werd er getracht de
genexpressie te verhogen, er is namelijk aangetoond dat introns de transcriptionele efficiëntie
van vele genen in een variëteit aan organismen positief beïnvloeden. In ons experiment echter,
was er geen verschil in genexpressie tussen de constructen met en de constructen zonder
introns (onder controle van de endogene promotor). Dit leidde tot het besluit dat introns bij
CDKA;1 en CDKB1;1 geen intron mediated enhancement (IME) veroorzaken, dit besluit mag
zeker niet veralgemeend worden omdat er sterke aanwijzingen zijn dat IME genafhankelijk is.
Er werden ook experimenten uitgevoerd om de expressie van het endogene CDKA;1 te
verlagen door middel van RNA geïnduceerde gene silencing (RNAi), meer bepaald door een
mechanisme van post-transcriptional gene silencing (PTGS). RNAi leidt wel enkel tot ‘gene
knock-down’, geen volledige silencing (‘gene knock-out’). De introductie van een
dubbelstrengig RNA (hairpin RNA in dit geval) in de plantencel, induceert een
sequentiespecifiek RNA-degradatie mechanisme dat op effectieve wijze het doelwit gen,
CDKA;1, afbreekt. Twee RNAi-hairpinconstructen werden gemaakt met de 3’UTR (sense en
anti-sense) van CDKA;1 en supergetransformeerd in transgene celculturen die CDKA;1-TAP
tot expressie brengen onder controle van de endogene CDKA;1-promoter. De resultaten uit
dit experiment waren veelbelovend, silencing van het endogene CDKA;1 werd waargenomen,
zonder dat het effect had op de transgene expressie van CDKA;1-TAP.
Een ander luik van het onderzoek was de vergelijking tussen C-TAP en N-TAP fusies.
Soms zal de toevoeging van een C-terminale tag aan een eiwit diens functie verhinderen of de
inbouw in complexen onmogelijk maken of significant verminderen. Een simpel alternatief is
het toevoegen van de tag aan de amino-terminus van het doelwitproteïne. Toevoeging van een
tag kan ertoe leiden dat sommige domeinen gemaskeerd worden en bijgevolg kan dit leiden
tot het uitblijven van bepaalde eiwit-interacties. Het is dus mogelijk dat er verschillende
interactoren opgepikt worden wanneer N-terminale versus C-terminale TAP-tagging
vergeleken wordt. De N-terminale TAP-tag bevat dezelfde modules als de C-terminale TAPtag, maar in omgekeerde volgorde.
NTAP-CKS1, NTAP-CycD3;1 en NTAP-CDKB1;1 werden getapt, met als bedoeling deze te
vergelijken met hun C-terminaal getagde tegenhangers en zo te zien met welke fusie de
meeste, biologisch actieve complexen kunnen gezuiverd worden. De resultaten van dit
120
Deel 5: Samenvatting
experiment echter, zullen bij het printen van de thesis nog niet voorhanden zijn, ze zullen op
een later tijdstip als addendum toegevoegd worden aan de thesis en zullen alleszins besproken
worden op de scriptievoorstelling.
121
Referenties
Referenties:
1. Alexandrov, N. N., M. E. Troukhan, V. V. Brover, T. Tatarinova, R. B. Flavell and K.
A. Feldmann (2006). "Features of Arabidopsis genes and genome discovered using
full-length cDNAs." Plant Mol Biol 60(1): 69-85.
2. Bauer, A. and B. Kuster (2003). "Affinity purification-mass spectrometry.
Powerful tools for the characterization of protein complexes." Eur J Biochem
270(4): 570-8.
3. Baulcombe, D. C. (1999). "Fast forward genetics based on virus-induced gene
silencing." Curr Opin Plant Biol 2(2): 109-13.
4. Bock, J. R. and D. A. Gough (2001). "Predicting protein--protein interactions from
primary structure." Bioinformatics 17(5): 455-60.
5. Bourdon, V., A. Harvey and D. M. Lonsdale (2001). "Introns and their positions
affect the translational activity of mRNA in plant cells." EMBO Rep 2(5): 394-8.
6. Brinster, R. L., J. M. Allen, R. R. Behringer, R. E. Gelinas and R. D. Palmiter (1988).
"Introns increase transcriptional efficiency in transgenic mice." Proc Natl Acad
Sci U S A 85(3): 836-40.
7. Brown, A. P., V. Affleck, T. Fawcett and A. R. Slabas (2006). "Tandem affinity
purification tagging of fatty acid biosynthetic enzymes in Synechocystis sp.
PCC6803 and Arabidopsis thaliana." J Exp Bot.
8. Butaye, K. M., I. J. Goderis, P. F. Wouters, J. M. Pues, S. L. Delaure, W. F. Broekaert,
A. Depicker, B. P. Cammue and M. F. De Bolle (2004). "Stable high-level transgene
expression in Arabidopsis thaliana using gene silencing mutants and matrix
attachment regions." Plant J 39(3): 440-9.
9. Camacho-Carvajal, M. M., B. Wollscheid, R. Aebersold, V. Steimle and W. W.
Schamel (2004). "Two-dimensional Blue native/SDS gel electrophoresis of multiprotein complexes from whole cellular lysates: a proteomics approach." Mol Cell
Proteomics 3(2): 176-82.
10. Causier, B. (2004). "Studying the interactome with the yeast two-hybrid system
and mass spectrometry." Mass Spectrom Rev 23(5): 350-67.
11. Constans, A. (2002). " Protein Purification II: Affinity Tags." The Scientist 16(4):
37.
122
Referenties
12. Desai, I. M. C. a. A. (2005). "A Combined Approach for the Localization and
Tandem Affinity Purification of Protein Complexes from Metazoans." Sci. STKE
2005(266): pl 1.
13. Droit, A., G. G. Poirier and J. M. Hunter (2005). "Experimental and bioinformatic
approaches for interrogating protein-protein interactions to determine protein
function." J Mol Endocrinol 34(2): 263-80.
14. Eubel, H., H. P. Braun and A. H. Millar (2005). "Blue-native PAGE in plants: a tool
in analysis of protein-protein interactions." Plant Methods 1(1): 11.
15. Fields, S. and O. Song (1989). "A novel genetic system to detect protein-protein
interactions." Nature 340(6230): 245-6.
16. Forler, D., T. Kocher, M. Rode, M. Gentzel, E. Izaurralde and M. Wilm (2003). "An
efficient protein complex purification method for functional proteomics in higher
eukaryotes." Nat Biotechnol 21(1): 89-92.
17. Gavin, A. C., M. Bosche, R. Krause, P. Grandi, M. Marzioch, A. Bauer, J. Schultz, J.
M. Rick, A. M. Michon, C. M. Cruciat, M. Remor, C. Hofert, M. Schelder, M.
Brajenovic, H. Ruffner, A. Merino, K. Klein, M. Hudak, D. Dickson, T. Rudi, V.
Gnau, A. Bauch, S. Bastuck, B. Huhse, C. Leutwein, M. A. Heurtier, R. R. Copley, A.
Edelmann, E. Querfurth, V. Rybin, G. Drewes, M. Raida, T. Bouwmeester, P. Bork,
B. Seraphin, B. Kuster, G. Neubauer and G. Superti-Furga (2002). "Functional
organization of the yeast proteome by systematic analysis of protein complexes."
Nature 415(6868): 141-7.
18. Goderis, I. J., M. F. De Bolle, I. E. Francois, P. F. Wouters, W. F. Broekaert and B. P.
Cammue (2002). "A set of modular plant transformation vectors allowing flexible
insertion of up to six expression units." Plant Mol Biol 50(1): 17-27.
19. Graumann, J., L. A. Dunipace, J. H. Seol, W. H. McDonald, J. R. Yates, 3rd, B. J.
Wold and R. J. Deshaies (2004). "Applicability of tandem affinity purification
MudPIT to pathway proteomics in yeast." Mol Cell Proteomics 3(3): 226-37.
20. Gruss, P., C. J. Lai, R. Dhar and G. Khoury (1979). "Splicing as a requirement for
biogenesis of functional 16S mRNA of simian virus 40." Proc Natl Acad Sci U S A
76(9): 4317-21.
21. Hamer, D. H., K. D. Smith, S. H. Boyer and P. Leder (1979). "SV40 recombinants
carrying rabbit beta-globin gene coding sequences." Cell 17(3): 725-35.
22. Hanahan, D. (1983). "Studies on transformation of Escherichia coli with
plasmids." J Mol Biol 166(4): 557-80.
123
Referenties
23. Hilson, P., J. Allemeersch, T. Altmann, S. Aubourg, A. Avon, J. Beynon, R. P.
Bhalerao, F. Bitton, M. Caboche, B. Cannoot, V. Chardakov, C. Cognet-Holliger, V.
Colot, M. Crowe, C. Darimont, S. Durinck, H. Eickhoff, A. F. de Longevialle, E. E.
Farmer, M. Grant, M. T. Kuiper, H. Lehrach, C. Leon, A. Leyva, J. Lundeberg, C.
Lurin, Y. Moreau, W. Nietfeld, J. Paz-Ares, P. Reymond, P. Rouze, G. Sandberg, M.
D. Segura, C. Serizet, A. Tabrett, L. Taconnat, V. Thareau, P. Van Hummelen, S.
Vercruysse, M. Vuylsteke, M. Weingartner, P. J. Weisbeek, V. Wirta, F. R. Wittink,
M. Zabeau and I. Small (2004). "Versatile gene-specific sequence tags for
Arabidopsis functional genomics: transcript profiling and reverse genetics
applications." Genome Res 14(10B): 2176-89.
24. Hink, M. A., T. Bisselin and A. J. Visser (2002). "Imaging protein-protein
interactions in living cells." Plant Mol Biol 50(6): 871-83.
25. Hirano, H., N. Islam and H. Kawasaki (2004). "Technical aspects of functional
proteomics in plants." Phytochemistry 65(11): 1487-98.
26. Ho, Y., A. Gruhler, A. Heilbut, G. D. Bader, L. Moore, S. L. Adams, A. Millar, P.
Taylor, K. Bennett, K. Boutilier, L. Yang, C. Wolting, I. Donaldson, S. Schandorff, J.
Shewnarane, M. Vo, J. Taggart, M. Goudreault, B. Muskat, C. Alfarano, D. Dewar, Z.
Lin, K. Michalickova, A. R. Willems, H. Sassi, P. A. Nielsen, K. J. Rasmussen, J. R.
Andersen, L. E. Johansen, L. H. Hansen, H. Jespersen, A. Podtelejnikov, E. Nielsen, J.
Crawford, V. Poulsen, B. D. Sorensen, J. Matthiesen, R. C. Hendrickson, F. Gleeson,
T. Pawson, M. F. Moran, D. Durocher, M. Mann, C. W. Hogue, D. Figeys and M.
Tyers (2002). "Systematic identification of protein complexes in Saccharomyces
cerevisiae by mass spectrometry." Nature 415(6868): 180-3.
27. Honey, S., B. L. Schneider, D. M. Schieltz, J. R. Yates and B. Futcher (2001). "A
novel multiple affinity purification tag and its use in identification of proteins
associated with a cyclin-CDK complex." Nucleic Acids Res 29(4): E24.
28. Honore, B., M. Ostergaard and H. Vorum (2004). "Functional genomics studied by
proteomics." Bioessays 26(8): 901-15.
29. Huynen, M. A. and P. Bork (1998). "Measuring genome evolution." Proc Natl Acad
Sci U S A 95(11): 5849-56.
30. Jarvik, J. W. and C. A. Telmer (1998). "Epitope tagging." Annu Rev Genet 32: 60118.
31. Knuesel, M., Y. Wan, Z. Xiao, E. Holinger, N. Lowe, W. Wang and X. Liu (2003).
"Identification of novel protein-protein interactions using a versatile mammalian
124
Referenties
tandem affinity purification expression system." Mol Cell Proteomics 2(11): 122533.
32. Krogan, N. J., G. Cagney, H. Yu, G. Zhong, X. Guo, A. Ignatchenko, J. Li, S. Pu, N.
Datta, A. P. Tikuisis, T. Punna, J. M. Peregrin-Alvarez, M. Shales, X. Zhang, M.
Davey, M. D. Robinson, A. Paccanaro, J. E. Bray, A. Sheung, B. Beattie, D. P.
Richards, V. Canadien, A. Lalev, F. Mena, P. Wong, A. Starostine, M. M. Canete, J.
Vlasblom, S. Wu, C. Orsi, S. R. Collins, S. Chandran, R. Haw, J. J. Rilstone, K.
Gandi, N. J. Thompson, G. Musso, P. St Onge, S. Ghanny, M. H. Lam, G. Butland, A.
M. Altaf-Ul, S. Kanaya, A. Shilatifard, E. O'Shea, J. S. Weissman, C. J. Ingles, T. R.
Hughes, J. Parkinson, M. Gerstein, S. J. Wodak, A. Emili and J. F. Greenblatt (2006).
"Global landscape of protein complexes in the yeast Saccharomyces cerevisiae."
Nature 440(7084): 637-43.
33. Le Hir H, N. A., Moore MJ (2003). "How introns influence and enhance
eukaryotic gene expression." Trends in biochemical sciences 28(4): 215-220.
34. Li, M. (2000). "Applications of display technology in protein analysis." Nat
Biotechnol 18(12): 1251-6.
35. MacBeath, G. and S. L. Schreiber (2000). "Printing proteins as microarrays for
high-throughput function determination." Science 289(5485): 1760-3.
36. MacBeath, G. (2002). "Protein microarrays and proteomics." Nat Genet 32 Suppl:
526-32.
37. Marcotte, E. M., M. Pellegrini, H. L. Ng, D. W. Rice, T. O. Yeates and D. Eisenberg
(1999). "Detecting protein function and protein-protein interactions from
genome sequences." Science 285(5428): 751-3.
38. May, M. J. and C. J. Leaver (1993). "Oxidative Stimulation of Glutathione
Synthesis in Arabidopsis thaliana Suspension Cultures." Plant Physiol 103(2):
621-627.
39. McCormack, A. L., D. M. Schieltz, B. Goode, S. Yang, G. Barnes, D. Drubin and J. R.
Yates, 3rd (1997). "Direct analysis and identification of proteins in mixtures by
LC/MS/MS and database searching at the low-femtomole level." Anal Chem
69(4): 767-76.
40. Menges, M. and J. A. Murray (2002). "Synchronous Arabidopsis suspension
cultures for analysis of cell-cycle gene activity." Plant J 30(2): 203-12.
41. Mullaney, B. P. and M. G. Pallavicini (2001). "Protein-protein interactions in
hematology and phage display." Exp Hematol 29(10): 1136-46.
125
Referenties
42. Palmiter, R. D., E. P. Sandgren, M. R. Avarbock, D. D. Allen and R. L. Brinster
(1991). "Heterologous introns can enhance expression of transgenes in mice."
Proc Natl Acad Sci U S A 88(2): 478-82.
43. Pellegrini, M., E. M. Marcotte, M. J. Thompson, D. Eisenberg and T. O. Yeates
(1999). "Assigning protein functions by comparative genome analysis: protein
phylogenetic profiles." Proc Natl Acad Sci U S A 96(8): 4285-8.
44. Peng, J., D. Schwartz, J. E. Elias, C. C. Thoreen, D. Cheng, G. Marsischky, J. Roelofs,
D. Finley and S. P. Gygi (2003). "A proteomics approach to understanding protein
ubiquitination." Nat Biotechnol 21(8): 921-6.
45. Phizicky, E. M. and S. Fields (1995). "Protein-protein interactions: methods for
detection and analysis." Microbiol Rev 59(1): 94-123.
46. Puig, O., F. Caspary, G. Rigaut, B. Rutz, E. Bouveret, E. Bragado-Nilsson, M. Wilm
and B. Seraphin (2001). "The tandem affinity purification (TAP) method: a
general procedure of protein complex purification." Methods 24(3): 218-29.
47. Rigaut, G., A. Shevchenko, B. Rutz, M. Wilm, M. Mann and B. Seraphin (1999). "A
generic protein purification method for protein complex characterization and
proteome exploration." Nat Biotechnol 17(10): 1030-2.
48. Rose, A. B. (2002). "Requirements for intron-mediated enhancement of gene
expression in Arabidopsis." Rna 8(11): 1444-53.
49. Rose, A. B. (2004). "The effect of intron location on intron-mediated
enhancement of gene expression in Arabidopsis." Plant J 40(5): 744-51.
50. Rubio, V., Y. Shen, Y. Saijo, Y. Liu, G. Gusmaroli, S. P. Dinesh-Kumar and X. W.
Deng (2005). "An alternative tandem affinity purification strategy applied to
Arabidopsis protein complex isolation." Plant J 41(5): 767-78.
51. Ruiz, M. T., O. Voinnet and D. C. Baulcombe (1998). "Initiation and maintenance
of virus-induced gene silencing." Plant Cell 10(6): 937-46.
52. Schagger, H. and K. Pfeiffer (2001). "The ratio of oxidative phosphorylation
complexes I-V in bovine heart mitochondria and the composition of respiratory
chain supercomplexes." J Biol Chem 276(41): 37861-7.
53. Shevchenko, A., D. Schaft, A. Roguev, W. W. Pijnappel and A. F. Stewart (2002).
"Deciphering protein complexes and protein interaction networks by tandem
affinity purification and mass spectrometry: analytical perspective." Mol Cell
Proteomics 1(3): 204-12.
126
Referenties
54. Tanaka, A., S. Mita, S. Ohta, J. Kyozuka, K. Shimamoto and K. Nakamura (1990).
"Enhancement of foreign gene expression by a dicot intron in rice but not in
tobacco is correlated with an increased level of mRNA and an efficient splicing of
the intron." Nucleic Acids Res 18(23): 6767-70.
55. Walter, G., K. Bussow, D. Cahill, A. Lueking and H. Lehrach (2000). "Protein arrays
for gene expression and molecular interaction screening." Curr Opin Microbiol
3(3): 298-302.
56. Waterhouse, P. M. and C. A. Helliwell (2003). "Exploring plant genomes by RNAinduced gene silencing." Nat Rev Genet 4(1): 29-38.
57. Wesley, S. V., C. A. Helliwell, N. A. Smith, M. B. Wang, D. T. Rouse, Q. Liu, P. S.
Gooding, S. P. Singh, D. Abbott, P. A. Stoutjesdijk, S. P. Robinson, A. P. Gleave, A.
G. Green and P. M. Waterhouse (2001). "Construct design for efficient, effective
and high-throughput gene silencing in plants." Plant J 27(6): 581-90.
58. Zeghouf, M., J. Li, G. Butland, A. Borkowska, V. Canadien, D. Richards, B. Beattie,
A. Emili and J. F. Greenblatt (2004). "Sequential Peptide Affinity (SPA) system for
the identification of mammalian and bacterial protein complexes." J Proteome
Res 3(3): 463-8.
59. Zhang, B., B. Kraemer, D. SenGupta, S. Fields and M. Wickens (1999). "Yeast
three-hybrid system to detect and analyze interactions between RNA and
protein." Methods Enzymol 306: 93-113.
60. Zhang, K. W., J. M. Wang and C. C. Zheng (2004). "[The potential role of nuclear
matrix attachment regions (MARs) in regulation of gene expression]." Sheng Wu
Gong Cheng Xue Bao 20(1): 6-9.
61. Zhu, H. and M. Snyder (2003). "Protein chip technology." Curr Opin Chem Biol
7(1): 55-63.
127
Download
Random flashcards
mij droom land

4 Cards Lisandro Kurasaki DLuffy

Rekenen

3 Cards Patricia van Oirschot

Create flashcards