TENTAMEN BIOCHEMIE

advertisement
HERTENTAMEN
BIOCHEMIE (8S135)
Woensdag 14 november 2007, 9.00–12.00
Het tentamen bestaat uit 7 opgaven.
Geef bij alle antwoorden een duidelijke uitleg.
1
Eiwitten zijn polypeptiden met structuur op diverse niveaus.
a.
b.
c.
d.
Teken de chemische structuur van een dipeptide naar uw keuze met 2
verschillende aminozuren, en geef de afgekorte aanduiding van uw
dipeptide.
Wat voor aminozuren zal een -helix bevatten die in het inwendige van
een eiwit gesitueerd is? Geef ook aan door welke interacties de stabiliteit
van de -helix tot stand komt.
Wat is de relatie tussen een rechtshandige en een linkshandige -helix?
Leg uit wat de rol van water is in de tertiaire structuur van een eiwit.
2
DNA-strengen van diverse lengte kunnen gescheiden worden m.b.v. gelelektroforese.
a.
b.
Leg uit hoe dit werkt, en wat de rol van SDS is.
Hoe is een specifiek DNA na de scheiding aan te tonen op de gel?
3
a.
b.
Ontwerp de active site van een enzym (met echte aminozuren) dat de
hydrolyse van een amide zou kunnen katalyseren.
Leg uit waarom een amide minder snel te hydrolyseren is dan een ester.
4
De reactiekinetiek van het enzym lysozym kan worden beschreven door KM = 6
M en een turnover number van 0,5 s–1.
a.
b.
c.
d.
Welke substraatconcentratie geeft een omzettingssnelheid van 0,1 M/s
bij een enzymconcentratie van 1 M?
Leg uit wat de waardes van KM en het turnover number betekenen in de
werking van het enzym.
Hoe groot is de kinetische perfectie van dit enzym? Leg uit wat dit begrip
betekent.
Leg uit wat voor effect een competitieve inhibitor heeft.
5
De stabiliteit van een DNA-duplex kan worden aangeduid met de
smelttemperatuur Tm.
a.
Leg uit hoe deze Tm gemeten kan worden.
b.
Noem minimaal 3 factoren die van invloed zijn op Tm.
c.
Verwacht u een Tm te zien voor GGACTGCAGTCC?
d.
Welke types enzymen zijn er nodig voor de replicatie van dubbelstrengs
DNA?
6
Een mRNA-transcript van gen van een T7 faag begint met de sequentie:
AACUGCACGAGGUAACACAAGAUGGCU
↑
a.
Als bij de pijl een mutatie plaatsvindt van G naar A, wat is dan het effect
op de translatie?
b.
Hoe kan de stof puromycine (zie hieronder) de translatie hinderen?
7
Biologische membranen vormen een semi-permeabele barriere. Lipiden in het
membraan zorgen voor de barriere-functie en eiwitten fungeren o.a. als kanalen
en pompen.
a.
b.
Hoe werkt een pomp-eiwit?
Noem minimaal 2 mogelijkheden om de fluïditeit van een membraan te
verhogen.
SUCCES
2. Op welke manier(en) kan behandeling van een eiwit met -mercaptoethanol het
gedrag van dit eiwit op een gelfiltratiekolom beïnvloeden?
Download
Random flashcards
fff

2 Cards Rick Jimenez

mij droom land

4 Cards Lisandro Kurasaki DLuffy

Create flashcards