Epigenetica Theorie en mogelijke implicaties
advertisement
Epigenetica Theorie en mogelijke implicaties Dr. Marco Boks Dr. Bart Rutten Disclosure Bart Rutten • Speaker fees received from: Lundbeck • Positions held on Advisory Boards: No • Grants and sponsoring: No Disclosure Marco Boks • Speaker fees received from: - Astra Zenica - Lundbeck • Positions held on Advisory Boards: - Geen • Grants and sponsoring: - Geen Stellingen • 1. Alleen de DNA sequentie (i.e. genetische factoren) is overerfbaar • 2. Het epigenetisch profiel van een individu is stabiel over de tijd • 3. Epigenetische mechanismen medieren de persistentie van de invloeden van omgevingsinvloeden op phenotypes Development of the number of citations including the term epigenetic. Gräff J et al. Physiol Rev 2011;91:603-649 ©2011 by American Physiological Society From epidemiology to neuroscience Hersenen Van Os, Kenis, Rutten. Nature. 2010 EPIGENETICS X Genotype unchanged Phenotype unchanged X X DNA mutation no DNA mutation Genotype changed Phenotype changed Genotype unchanged Phenotype changed Epigenetic Mechanisms • • • DNA methylation histone tail alterations microRNA, etc… 2 meters DNA per cell millions of neurons Epigenetics & the environment = changes in phenotype and/or gene expression by mechanisms other than changes in the DNA sequence itself ENVIRONMENT` DNA Methylation ↓Gene Transcription MTHFR, DNMT1, DNMT3a, DNMT3b methyl gene promoter exon 1 exon 2 I. blocks transcription factors II. attracts gene repressing molecules quantity * e.g. MeCP2, mutations in MeCP2 -> Rett syndrome Pishva et al. Translational Neuroscience. 2012 Agouti ACATATACGCGCGCGCGCGCGCGATATATCTGTCAA Agouti-gen promoter exon 1 exon 2 Jirtle et al. NRG 2007 Identical genotype Agouti X X = methyl pregnancy Jirtle et al. NRG 2007 Postnatal environment methyl administration Low maternal care High maternal care glucocorticoid receptor gene methyl promoter exon 1 exon 2 RNA of glucocorticoid receptor in hippocampus Epigenetics and childhood trauma in human brain Glucocorticoid receptor methylation Glucocorticoid receptor mRNA expression McGowan et al. Nature Neuroscience 2009 DNA methylation in psychosis Histone Tail Alterations Tsankova et al. NRN 2007 Social Stress bdnf gene bdnf bdnf Hippocampus protein no stress BDNF bdnf bdnf bdnf chronic stress BDNF bdnf bdnf bdnf chronic stress chronic TCA BDNF Tsankova et al. NRN 2007 Genes regulating chromatin & bipolar disorder? Genetic variations in genes involved in H3K4 methylation show associations with bipolar disorder Transgenerational Epigenetics pregnant female Altered DNA methylation Several generations: Identical genetic sequence Identical environment Altered DNA methylation Altered phenotype F4 Anyway et al. Science 2005 Jirtle et al. NRG 2007 History repeating? Jean-Baptiste Lamarck 1744 -1829 Theory: Heritability of acquired traits Lamarckism 1920s, William McDougall: training rats in a maze Offspring of trained rats >> offspring of non-trained rats Environment DNA SNP/mutation gene promoter exon 1 exon 2 EPIGENETIC RNA Inheritable Protein quantity Cell functions quality Working model Subclinical experiences Paternal age Maternal infection Childhood trauma Perinatal events Maternal stress Nutrition Rearing environment Hypoxia Prodromal state Disorder Cannabis Urban environment Stress Migration Rutten & Mill. Schiz Bull. 2009 Epigenetica: theorie en mogelijke implicaties Deel II Marco Boks Bart Rutten Stelling Epigenetische veranderingen zijn zeldzaam • Relatie met psychiatrische aandoeningen • Relatie met medicatie • Omgevingsinvloed • Quiz Wat is interessant aan epigenetica? • • • • • Erfelijk Omgeving Trans generationele leer effecten Belangrijk in ontwikkeling Beïnvloedbaar door medicatie en dieet Uitdagingen • • • • Invloed leeftijd en geslacht Invloed van DNA sequence variatie Invloed van medicatie Weefsel type Correlatie tussen bloed en brein voor methylation levels onder invloed van leeftijd Horvath et al. Genome Biology 2012 13:R97 Sample plot of methylation levels by genotype groups Boks MP et al. The relationship of DNA methylation with age, gender and genotype in twins and healthy controls. PLoS One. 2009. Cis and Trans correlations between DNA methylation and gene expression van Eijk KR, de Jong S, Boks MP, et alBMC Genomics. 2012 Nov 17;13(1):636. Stelling “Epigenetische” medicijnen zijn volop in ontwikkeling MPM Boks et al, Epigenetics, 2012 Boks MP, de Jong NM, Kas MJ, Vinkers CH, Fernandes C, Kahn RS, Mill J, Ophoff RA. Current status and future prospects for epigenetic psychopharmacology. Epigenetics. 2012 Jan 1;7(1) Stelling De belangrijkste invloed op epigenetica is voor de geboorte Omgevingsinvloed • • • • • • • Prenatal nutrition Prenatal exposure to alcohol Other drugs of abuse Prenatal stress Maternal care Traumatic early life experiences Environmental enrichment Kofink, Boks, Kas, Neuroscience and Biobehavioral Reviews, in press Psychiatrische aandoeningen • • • • • • • Depressie Autisme Schizofrenie Bipolaire stoornis Cocaïne afhankelijkheid Alcoholisme Alzheimer Bunnik Angry Bird Epigenetics Award • 12 stellingen • Rechterhand omhoog is JUIST • Bij fout antwoord gaan zitten Vragen • Er zijn meer dan 25 epigenetische mechanismen • Honger voor de geboorte heeft effect op de epigenetische status van het kind • Met de leeftijd neemt DNA methylatie af (alles wordt minder). • Er zijn geen medicijnen die direct op DNA methylatie werken • Natriumvalproaat is een HDAC inhibitor • DNA methylatie verlaagd de expressie van genen Vragen? Universiteit Maastricht Bart Rutten [email protected] UMC Utrecht Marco Boks [email protected] [email protected]
