CRISPR/Cas-gemedieerde genmanipulatie en de potentiële

advertisement
OVERZICHTSARTIKELEN
29
CRISPR/Cas-gemedieerde
genmanipulatie en de potentiële
toepassing voor hematologische
stoornissen
CRISPR/Cas-mediated gene editing and the potential application in
hematological disease
dr. T. Csikós1 en dr. R. Groen2
SAMENVATTING
SUMMARY
Als er één discipline is in de kliniek die zal profiteren
van de recente significante ontwikkelingen op het
gebied van genmodificatietechnologieën is het de
hematologie, aangezien duidelijk gedefinieerde afwijkingen in het menselijk genoom de basis vormen
voor een reeks aan hematologische ziekten. In dit
overzichtsartikel beschrijven wij CRISPR/Cas en hoe
het wordt ingezet in de hematologie; ontwikkelingen
die mogelijk zullen leiden tot gentherapie.
If there is one discipline in the clinic which will profit
from the recent major advances made in gene modification technologies, it must be hematology, since
many hematological disorders are based on well
described aberrations in the human genome. In this
review we describe CRISPR/Cas and the inroads it is
making in hematology-based research; developments
which might lead to gene therapy.
(NED TIJDSCHR HEMATOL 2017;14:29-38)
INLEIDING
Door de introductie van het CRISPR/Cas-systeem
(‘clustered regularly interspaced palindromic repeats/
CRISPR associated protein’; zie Figuur 1, pagina 30)
in het laboratorium, is genmanipulatie in een stroomversnelling geraakt. Het is een methode om snel genen
aan of uit te zetten of om genen te introduceren in
allerlei levende wezens, zoals bacteriën, planten, dieren
en ook in menselijke cellen. Het CRISPR/Cas-systeem
is oorspronkelijk een afweermechanisme van bacteriën
tegen virusinfecties. Wanneer een virus zijn DNA in
de bacterie heeft gebracht, wordt het door het CRISPR/
Cas-systeem herkend, kapot geknipt en daarmee onschadelijk gemaakt.
Voordat het CRISPR/Cas-complex was beschreven,
zijn in het afgelopen decennium in het laboratorium
al systemen ontwikkeld om DNA efficïent en specifiek
te manipuleren.1 Hiervoor maken deze technieken,
genaamd ‘zinc-finger nucleases (ZFN’s) en ‘transcription activator-like effector nucleases’ (TALEN’s), gebruik
van in een cel bestaande DNA-herstelmechanismen,
‘non-homologous end joining repair’ (NHEJ) en ‘homology-directed repair’ (HDR).2,3 Waar de ZFN’s- en de
TALEN’s-systemen gebruikmaken van DNA-knippende
enzymen, de endonucleases, die gebonden zijn aan een
rij proteïnen om ze op een specifieke plek te krijgen
in het genoom, daar laat de Cas-endonuclease zich
simpelweg door kleine stukjes RNA leiden naar com-
onderzoeker, 2universitair docent, afdeling Hematologie, VU medisch centrum. Correspondentie graag richten aan dhr. dr. R. Groen, universitair
1
docent, afdeling Hematologie, VU medisch centrum, De Boelelaan 1117, 1081 HV Amsterdam, tel.: 020 444 26 04, e-mailadres [email protected]
Belangenconflict: geen gemeld. Financiële ondersteuning: geen gemeld.
Trefwoorden: CRISPR/Cas, gentherapie, hemoglobinopathieën
Keywords: CRISPR/Cas, gene therapy, hemoglobinopathy
1
JA A RG A NG14 J A N U A R I 2 017
30
Virus
tracrRNA:cRNA leidt de Cas9endonuclease naar het viraal
DNA om het te knippen (3).
Spacer-sequentie (1).
Adaptatie:
Aanval op virus-DNA
CRISPR-array (2).
RNaseIII
pre-crRNA
crRNAmaturatie:
Cas9
tracrRNA
Bacterie
FIGUUR 1. CRISPR-gemedieerde immuniteit. CRISPR’s, of CRISPR-arrays, zijn regio’s in het bacterieel genoom die de bacterie
helpen om zich te verdedigen tegen een virusaanval. Deze CRISPR-arrays bestaan uit korte DNA-‘repeats’ (zwarte ruiten)
met daartussen specifieke spacer-DNA-sequenties (gekleurde vierkanten). Zodra viraal DNA in de bacterie terechtkomt,
wordt een specifieke spacer-DNA-sequentie van het virusgenoom afgeleid (1) en in de CRISPR-array ingebouwd (2). Als de
bacterie op een gegeven moment weer door eenzelfde virus wordt aangevallen, gaat de bacterie CRISPR-RNA’s (crRNA’s)
produceren, die de specifieke spacer-sequentie bevat. Deze crRNA-moleculen worden afgeleid van het precursor-crRNA
(pre-crRNA). Voor dit proces zijn drie componenten nodig; de Cas9-endonuclease, een ‘trans-activating’ crRNA (tracrRNA)
en ribonuclease III (RNaseIII). De tracrRNA:crRNA combimolecuul associeert zich vervolgens met de Cas9-nuclease en leidt
deze naar de specifieke DNA-sequentie in het viraal genoom die door de spacer-sequentie wordt herkend. Hierdoor bindt de
bacteriële Cas9-endonucleasecomplex aan het viraal DNA en is dan in staat om het virus-DNA te knippen (3). Voor een
gedetailleerde beschrijving van het CRISPR/Cas9-systeem zie: Doudna JA, Charpentier E. Genome editing. The new frontier
of genome engineering with CRISPR-Cas9. Science 2014.
JA A RG A NG14 J A N U A R I 2 017
31
OVERZICHTSARTIKELEN
CRISPR/Cas9 knipt DNA:
DNA-cassette:
NHEJ
HDR
FIGUUR 2. CRISPR/Cas9-systeem gemedieerde genmodificatie. Zodra het CRISPR/Cas9-systeem een dubbelstrengs
DNA heeft geknipt, treedt de cellulaire DNA-herstelmachine in werking, namelijk de ‘non-homologous end joining’ (NHEJ) of
‘homology-directed repair’ (HDR). NHEJ kan leiden tot kleine inserties of deleties waardoor een gen kan worden uitgeschakeld.
Aangezien de sequentie van een DNA-cassette bekend is, kan door HDR-geassisteerde insertie van die cassette, specifiek
een gen worden gecorrigeerd of verstoord.
plementaire sequenties in het genoom, wat inhoudt
dat het nu veel makkelijker en efficiënter is om DNA te
modificeren.4
Zodra het DNA wordt geknipt, komen de DNA-herstelmechanismen in werking, de foutgevoelige NHEJ, wat
leidt tot de introductie van kleine inserties of deleties
tijdens het re-ligeren van de gebroken DNA-strengen en
de HDR, waardoor complete DNA-expressiecassettes
in de positie van de mutatie kunnen worden ingebouwd
door homologe recombinatie (Figuur 2).5-7
Onafhankelijk van de DNA-herstelmechanismen is
het ook mogelijk de endonucleases te vervangen door
andere DNA-modificerende proteïnen om specifieke
DNA-sequenties of histonen te methyleren, te demethyleren, RNA-transcriptie te activeren of te remmen.2
In dit overzichtsartikel wordt de werking en de potentiële toepassing van het CRISPR/Cas-systeem in de
hematologie verder besproken.
WAT IS CRISPR/CAS?
CRISPR/Cas is een prokaryotisch verdedigingssysteem
wat te vinden is in 50% van bacteriën en in 90% van
de archae, en staat voor ‘clustered regularly interspaced
palindromic repeats/CRISPR associated protein’.8,9
Het prokaryotische CRISPR/Cas-immuunsysteem is te
vergelijken met het menselijk adaptief immuunsysteem
(zie Figuur 1). Het is in staat informatie te verzamelen
van eerdere bacteriofaaginfecties, waardoor de gastheer
snel kan reageren op een re-infectie. De CRISPR/Cassystemen worden in het algemeen gedefinieerd door
een genomisch locus, genaamd de CRISPR-‘array’, die
bestaat uit een rij identieke DNA-sequenties (‘repeats’),
die van elkaar gescheiden zijn door ‘spacer’-sequenties
van vergelijkbare lengte. In 1987 zijn deze ‘arrays’
beschreven door een Japanse onderzoeksgroep, maar
het heeft nog jaren geduurd voordat men erachter
kwam dat de ‘spacer’-sequenties identiek zijn aan die
in fagen en plasmiden.10-13 De observatie dat CRISPR‘arrays’ dezelfde sequenties bevatten als plasmiden
en bacteriofagen leidde tot de hypothese dat CRISPR‘arrays’ de basis vormen van het bacteriële immuunsysteem.14,15
HOE WERKT CRISPR/CAS?
Er zijn tot nu toe zes CRISPR/endonuclease-typen,
of beter uitgedrukt, CRISPR/effectorenzym-typen, beschreven waarvan type II, ook wel bekend als het
CRISPR/Cas9, het bekendste is.16 Typen I, III en IV
maken gebruik van eiwitcomplexen samengesteld uit
verschillende effector-enzymen, terwijl CRISPR/effectorenzym-type II, V en VI maar één enkele effectorenzym
nodig hebben voor RNA-geleide enzymactiviteit. Het is
1
JA A RG A NG14 J A N U A R I 2 017
32
A
Exon:
1
2
3
4
5
6
5’
3’
1 kb
B
Doelsequentie:
5’-TAAACGAGTATAGTCATGGCTTATAGCGCACGCGGCCAGGCAGTACGTGTTCGCG-3’
PAM-sequentie
C
Cas9
GGCTTATAGCGCACGCGGCC
5’-TAAACGAGTATAGTCAT
AGGCAGTACGTGTTCGCG-3’
3’-ATTTGCTCATATCAGTA
TCCGTCATGCACAAGCGC-5’
CCGATTATCGCGTGCGCCGG
5’ GGCTAATAGCGCACGCGGCC
crRNA
3’
sgRNA
tracrRNA
Verbindingssequentie
FIGUUR 3. Een DNA-doelsequentie die specifiek wordt geknipt met het CRISPR/Cas9-systeem. In een fictief gen, van
ongeveer 15 kilobasen lang, is in exon 2 een kandidaat-doelsequentie geindentificeerd (A). Het CRISPR/Cas9-complex kan
alleen aan de doelsequentie binden, als deze sequentie direct wordt gevolgd door een PAM-sequentie (B). De PAM-sequentie
is een N-nucleotide gevolgd door twee guaninenucleotiden (5’ NGG 3’), waar N een van de vier nucleotiden kan zijn. Om de
DNA-doelsequentie 5’ GGCTTATAGCGCACGCGGCC 3’ met CRISPR/Cas9-systeem te muteren, wordt een sgRNA-molecuul
gemaakt die deze sequentie bevat (C). De lengte van de doelsequentie kan variëren; in dit voorbeeld zijn 20 nucleotiden
complementair met de doelsequentie, gevolgd door de crRNA, een verbindingssequentie en de tracrRNA. Samen vormen
ze de sgRNA-molecuul. De sgRNA- en de Cas9-nuclease vormen een complex dat in het genoom de doelsequentie bindt
en knipt (C, driehoeken).
deze eigenschap die deze laatste drie systemen zo
bruikbaar maken in recombinante genapplicaties.
De adaptieve immuniteit door CRISPR/Cas9 verloopt
globaal in drie stappen (zie Figuur 1).3,16 Eerst wordt
een korte DNA-sequentie (de ‘protospacer’), afkomstig
van een invasief organisme of niet-eigen DNA, als
JA A RG A NG14 J A N U A R I 2 017
een ‘spacer’-sequentie in de CRISPR-‘array’ ingebouwd.
In de tweede fase vindt transcriptie van precursor
CRISPR-RNA plaats, wat vervolgens matureert in
CRISPR-RNA (crRNA), bestaande uit een ‘repeat’gedeelte en het ‘spacer’-gedeelte. Voor crRNA-maturatie
zijn drie componenten nodig, namelijk een klein
OVERZICHTSARTIKELEN
RNA-molecuul, de ‘trans-activating’ cRNA (tracrRNA),
de ribonuclease-RNaseIII en de Cas9-endonuclease.
In de laatste fase hybridiseert het gevormde crRNA
met de complementaire streng van de doelsequentie in
het invasieve DNA, waarna de Cas9-endonuclease het
DNA kan knippen (zie Figuur 1).
In 2011 werd ontdekt dat het tracrRNA essentieel
is voor crRNA-maturatie in de immuunreactie tegen
parasitair DNA.17 Een jaar later werd duidelijk dat het
tracrRNA samen met het crRNA en een endonuclease,
Cas9, het type II CRISPR/Cas-complex vormt.4 Het
CRISPR/Cas9-complex kan alleen aan de doelsequentie
binden als de 20 nucleotiden van het crRNA complementair is met de antisense doelsequentie en als de
doelsequentie direct wordt gevolgd door een PAMsequentie (zie Figuur 3).18 De PAM-sequentie is een
willekeurig nucleotide (N) gevolgd door twee guaninenucleotiden (5’ NGG 3’).
CRISPR/CAS IN HET LABORATORIUM
Voortbordurend op deze kennis zijn in het laboratorium
vervolgens de twee RNA-moleculen, tracrRNA en
crRNA, omgebouwd tot één RNA-structuur, de ‘single
guide’-RNA (sgRNA), waarbij de enkelstrengs 20 nucleotiden aan de 5’-kant van de sgRNA hybridiseert met de
complementaire doelsequentie en waarbij de dubbelstrengs 3’-kant zich associeert met de Cas9-endonuclease (zie Figuur 3C).4 Op deze manier is er een tweecomponentensysteem ontwikkeld waarmee door de
uitruil van de 20 nucleotiden in de sgRNA in principe
overal in het genoom kan worden geknipt zolang aan
de voorwaarde wordt voldaan dat de doelsequentie
direct wordt gevolgd door een PAM-sequentie.
In Figuren 3 en 4, pagina 34, wordt getoond hoe een
specifieke sequentie in het genoom kan worden geknipt
door het CRISPR/Cas9-systeem, waarna in de mutatie
die is ontstaan een expressiecassette wordt ingebouwd
door HDR om het gen van interesse uit te schakelen.
De sgRNA-molecuul met de specifieke doelsequentie
komt tot expressie zodra het in een cel terechtkomt.
Met eenvoudige standaardmethoden wordt deze cassette met PCR gemaakt en in een mix met twee andere
DNA-expressiecassettes in een cel getransporteerd,
waarvan één cassette de Cas9-endonuclease, terwijl
de andere cassette, simultaan, een fluorescerend eiwit
en een antibioticaresistent eiwit tot expressie brengt
(zie Figuur 4).19 Deze laatste reportercassette bevat
nucleotide sequenties aan de uiteinden die 100% identiek zijn met de sequenties die de doelsequentie in het
genoom flankeren, de zogenoemde homologie-armen.
33
Binnen 24 uur na DNA-transport in de cel is de fluorescerende marker zichtbaar. Het DNA dat de cel is
ingebracht, wordt minder na elke celdeling en wordt
actief uit de cel verwijderd, tenzij het DNA in het
genoom wordt ingebouwd. Als na enkele dagen antibiotica aan de celcultuur wordt toegevoegd, zullen
alleen die cellen overleven die de reportercassette in
het genoom hebben ingebouwd (zie Figuur 4C). Deze
inbouw is dus het gevolg van de HDR, dat wordt geprovoceerd door het specifieke sgRNA/Cas9-endonucleasecomplex dat in de cellen tot expressie is gebracht.
Dit voorbeeld beschrijft hoe in een relatief simpel experiment in het laboratorium in sneldelende cellen door
CRISPR/Cas9 een gen wordt uitgeschakeld door de
inbouw van een fluorescerende marker. Deze methode
wordt in het laboratorium vaak ingezet om een gen uit
te schakelen, omdat de fluorescerende cellen eenvoudig
kunnen worden geïdentificeerd en geïsoleerd voor
studies naar een mogelijk fenotype als gevolg van de
gendisruptie. Voor klinische toepassingen kan uiteraard
geen gebruik worden gemaakt van deze reportercassettes
die in het genoom worden ingebouwd, maar zullen de
gemuteerde of gerepareerde cellen op een andere wijze
moeten worden geïdentificeerd en geïsoleerd. Ook is
het belangrijk erop te wijzen dat de efficiëntie van het
CRISPR/Cas9-systeem afhankelijk is van factoren zoals
het celtype waarmee wordt gewerkt, de keuze van het
kandidaatgen om te manipuleren en de uiteindelijk
beoogde genetische manipulatie (bijvoorbeeld gendisruptie of gencorrectie). Niet alle celtypen laten zich
eenvoudig manipuleren en door de complexe structuur
van het actieve genoom zal niet elk gen even makkelijk
door het CRISPR/Cas9-complex benaderd en daardoor
gemanipuleerd kunnen worden.
PREKLINISCHE TOEPASSING VAN CRISPR/
CAS BIJ HEMATOLOGISCHE AFWIJKINGEN
CRISPR/CAS EN HIV-INFECTIE
Een voor de hand liggende pathologie waar CRISPR/
Cas kan worden ingezet in de behandeling is hiv/aids.
Wereldwijd zijn ongeveer 40 miljoen mensen met hiv
geïnfecteerd, en per jaar komen er meer dan 2 miljoen
infecties bij.20 Hoewel antivirale therapie beschikbaar
is, blijven patiënten levenslang afhankelijk van medicijngebruik om virale replicatie te onderdrukken.21
Recentelijk hebben Kaminski et al. in muizen en ratten
HIV-1-geïntegreerd DNA met CRISPR/Cas9 gemuteerd,
waardoor transcriptie van het virus-RNA, in bloedmonsters, drastisch werd verminderd.22 Ook hebben ze
aangetoond dat in een fractie van de cellen geïsoleerd
1
JA A RG A NG14 J A N U A R I 2 017
34
A
5’-
-3’
ds
Cas9
sgRNA’s
5’-
U6
5’-
TTTTTT-3’
gfp
puro
-3’
B
5’-
5’-
C
-3’
ds
gfp
puro
5’-
5’-
-3’
-3’
gfp
puro
-3’
FIGUUR 4. Een DNA-doelsequentie die specifiek wordt geknipt met het CRISPR/Cas9-systeem, gevolgd door homologe
recombinatie. Om de DNA-doelsequentie (ds) te muteren, wordt Cas9 en sgRNA tot expressie gebracht. In dit voorbeeld
wordt een cel getransfecteerd met een Cas9-expressievector, een PCR-gegenereerde sgRNA-expressiecassette en een
DNA-duoreporter-expressiecassette (A). De Cas9 wordt door een reguliere RNA-polymerase-II-promoter tot expressie
gebracht, terwijl de sgRNA door de U6-RNA-polymerase-III-promoter tot expressie wordt gebracht. De sgRNA en de
Cas9-nuclease vormen een complex dat de doelsequentie specifiek bindt en knipt (B). Het DNA-herstelmechanisme dat
hierdoor in werking treedt, zorgt ervoor dat de DNA-duoreporter-expressiecassette, met aan de uiteinden DNA-sequenties,
die 100% homoloog zijn met de DNA-sequenties rond de aangebrachte mutatie, door homologe recombinatie op de plek
van de breuk wordt ingebouwd (C). De cellen die de DNA-duoreporter-expressiecassette in het genoom hebben ingebouwd
blijven resistent tegen puromycine (puro) en brengen ‘green fluorescent protein’ (gfp) tot expressie, zodat deze cellen, met de
specifieke mutatie, eenvoudig kunnen worden geselecteerd.
JA A RG A NG14 J A N U A R I 2 017
OVERZICHTSARTIKELEN
uit de hersenen, hart, nieren, longen, milt en de lever,
het geïntegreerde virus-DNA door CRISPR/Cas9 werd
gemuteerd. Deze studie laat zien dat het dus mogelijk
is om CRISPR/Cas9 systemisch aan volwassen dieren
toe te dienen om vervolgens in geïnfecteerde cellen het
geïntegreerde hiv-genoom te muteren, maar dat de
therapeutische impact laag is. Een groot deel van de
cellen behield immers het intacte hiv-genoom. Dit is
illustratief voor het probleem hoe deze genmodificerende
systemen efficiënt in volwassen patiënten te krijgen,
nog los van het feit dat er ongewilde bijwerkingen
kunnen ontstaan. In deze studie werden de muizen en
ratten in de staartvene geïnjecteerd met adeno-geassociëerde virussen (AAV’s), met daarin DNA coderend
voor het CRISPR/Cas9-systeem. De AAV’s zijn al ingezet
in humane gentherapie als transgendragers.23 In tegenstelling tot retrovirussen, die ook in gentherapie worden
ingezet, integreren AAV’s sporadisch in het genoom,
induceren ze lage toxiciteit, en hoewel de viruspopulatie
bij elke celdeling minder wordt, blijven ze in staat om
transgenen tot expressie te brengen tot 12 maanden
na een eenmalige injectie.24 Een nadeel van deze AAV’s
is de beperkte transgencapaciteit. Alleen kleine DNAfragmenten kunnen worden meegenomen in het virusgenoom. Voor deze studie is daarom een 25% kleinere
Cas9-homoloog gebruikt, geïsoleerd uit staphyloccoccus
aureus, zodat er nog ruimte in het virusgenoom
overbleef voor twee sgRNA-expressiecassettes, voor
het knippen in het hiv-genoom. In de veronderstelling
dat kleinere transgenen efficiënter zijn af te leveren
bij relevante patiënten, wordt onderzoek gedaan naar
kleinere Cas-varianten, die in combinatie met gRNA’s
in staat zijn DNA te muteren, en ligt het in de verwachting
dat alternatieve CRISPR/Cas-systemen zullen worden
beschreven.25
CRISPR/CAS IN SIKKELCELANEMIE EN
β-THALASSEMIE
Een andere groep hematologische aandoeningen die
zouden kunnen worden behandeld met het CRISPR/
Cas-systeem zijn de hemoglobinopathieën sikkelcelanemie (SCA) en β-thalassemie.26 Deze ziekten zijn het
resultaat van mutaties in het β-globinegencluster op
chromosoom 11, en zijn de meest voorkomende monogene aandoeningen wereldwijd.27 Ongeveer 4,5% van
de wereldbevolking draagt β-thalassemie-geassocieerde
mutaties.27 SCA is het resultaat van een nucleotidesubstitutie in aminozuurcodon 6 van het β-globinegen,
waardoor codon 6 verandert van glutaminezuur (GAG)
naar valine (GTG), terwijl β-thalassemieën worden
35
veroorzaakt door diverse puntmutaties of deleties in
het gencluster op chromosoom 11.26 Behandeling van
deze ziekten is voornamelijk ondersteunend en genezing
van β-thalassemieën en SCA is tot dusver alleen mogelijk
door allogene stamceltransplantatie, een behandeling
gelimiteerd door de beschikbaarheid van geschikte
donoren en de kans op graft-versus-hostziekte.27
Genetisch gemodificeerde hematopoëtische stamcellen
(HSC’s) liggen aan de basis van potentiële therapie
voor dit soort hematologische aandoeningen. Om deze
genetisch gemodificeerde cellen in handen te krijgen,
worden eerst geïnduceerde pluripotente stamcellen
(iPSC’s) afgeleid uit cellen afkomstig van patiënten.28
Doordat deze iPSC’s blijven delen en lang in kweek
zijn te houden, zijn ze relatief eenvoudig genetisch te
manipuleren. Kandidaatklonen worden vervolgens tot
HSC’s gedifferentieerd en teruggeplaatst in de patiënt,
waar de genetisch gemodificeerde HSC’s als bron voor
normale erytrocyten moeten gaan dienen. Het is
overigens nog niet gelukt om op een robuuste en
betrouwbare manier transplantabele HSC’s te ontwikkelen.29,30 Hoe dan ook zijn binnen de context van de
bovengenoemde strategie ondertussen stappen gezet
om de SCA-mutatie met CRISPR/Cas te herstellen in
uitgedifferentieerde cellen. Het was al eerder aangetoond
dat het met ZFN’s en TALEN’s, in iPSC’s en cellijnen,
mogelijk is om de SCA-puntmutatie te herstellen, en
preklinisch onderzoek, gebruikmakend van iPSC’s
afgeleid uit cellen afkomstig van patiënten, laat inderdaad zien dat het mogelijk is om de SCA-puntmutatie
en β-thalassemiemutaties te herstellen.28,31-35 Huang
et al. hebben met CRISPR/Cas9 één allel hersteld, in
iPSC-lijnen, afgeleid uit cellen van patiënten die homozygoot zijn voor de SCA-mutatie.33 De herstelde iPSC’s
werden uitgedifferentieerd tot erytrocyten, die mutatievrij β-globine bleken te bevatten. Daarnaast werd de
specificiteit van het CRISPR/Cas9-systeem geverifieerd,
aangezien DNA-sequenties rond het locus waar homologe recombinatie met het donorconstruct moet plaatsvinden, zeer homoloog is met sequenties in de nabijgelegen genen. In dit onderzoek wordt voorgesteld om
dit genetisch gemodificeerd erytrocytmodel in te zetten
als patiëntspecifieke transfusietherapie, aangezien het
nog niet mogelijk is om transplantabele HSC’s te ontwikkelen uit iPSC’s.29,30
In een andere studie hebben Song et al. de CRISPR/
Cas9-technologie ingezet om β-thalassemiemutaties te
herstellen.34 Ook zij hebben iPSC’s geïnduceerd, maar nu
van somatische cellen, geïsoleerd uit een β-thalassemiepatiënt die drager is van een homozygote mutatie in het
1
JA A RG A NG14 J A N U A R I 2 017
36
VERKLARENDE WOORDENLIJST
DNA-expressiecassette Een DNA-fragment met daarin alle informatie gecodeert, waardoor de celtranslatiemachinerie
in staat is om van daaruit RNA en vervolgens eiwit te produceren.
Archae
Prokaryotische organismen, ook wel oerbacteriën of archaebacteriën genoemd.
Faag of bacteriofaag
Virus dat parasiteert op een bacterie.
Plasmide
Een cirkelvormige streng DNA die zich buiten het chromosomaal DNA bevindt van
sommige eencellige organismen. Kunstmatige plasmiden worden in biotechnologische
laboratoria gebruikt om genetische modificaties uit te uitvoeren.
Endonuclease
Een enzym dat een fosfodiësterverbinding kan knippen in een polynucleotide molecuul
(zoals DNA).
β-globinegen, en laten zien dat de gecorrigeerde iPSC’s
een normaal karyotype hebben, volledig pluripotent
zijn, geen onverwachte bijeffecten hebben na CRISPR/
Cas-expressie, in staat zijn om veel efficiënter te differentiëren tot HSC’s vergeleken met de originele gemuteerde iPSC’s en, niet onbelangrijk, dat de herstelde
cellen mutatievrije β-globine tot expressie brengen.37,38
CRISPR/CAS EN TROMBOCYTEN-GERELATEERDE
PATHOLOGIE
Het CRISPR/Cas-systeem biedt ook perspectieven om
eventueel genetisch gemodificeerde trombocyten te
produceren voor gebruik in de kliniek. Trombocyten
die door de aanwezigheid van allo-antigenen in hun
membraan verantwoordelijk zijn voor ernstige fenotypen,
zijn moeilijk te isoleren voor fundamenteel onderzoek.
Allo-antigenen zijn te vinden in de membraanglycoproteïnen en zijn het resultaat van een enkelvoudig
polymorfisme in het gen op humaan chromosoom 17,
dat codeert voor de integrine-β3-module, onderdeel
van de fibrinogeenreceptor. De aminozuur Leu33Propolymorfisme is verantwoordelijk voor het ontstaan van
het allo-antigene epitoop. De antilichamen die hiertegen
worden gevormd veroorzaken ernstige afwijkende hemostases, waaronder foetale en neonatale trombocytopenie
en posttransfusiepurpura.
In een ‘proof-of-principle’-studie zijn relevante cellijnen
en iPSC’s met behulp van CRISPR/Cas9 gemodificeerd
voor allo-antigeenspecifieke polymorfismen, waarna
deze cellen zijn uitgedifferentieerd tot megakaryocytvoorlopercellen.36 Deze cellen zijn ontwikkeld voor
het opzetten van gevoeligere detectiemethoden voor de
JA A RG A NG14 J A N U A R I 2 017
diagnose in de kliniek, en voor fundamenteel onderzoek dat uiteindelijk moet leiden tot nieuwe therapieën.
HET CRISPR/CAS-SYSTEEM IN KLINISCHE
STUDIES
Hoewel het CRISPR/Cas-systeem vaak wordt aangehaald als zeer efficiënt, zijn het de ZNF’s, die tot
dusver als enige van de genoemde genrecombinatietechnologieën de volledige translatie hebben doorgemaakt tot een klinische studie.37 In deze studie werd
het CCR5-gen gecorrigeerd met behulp van ZFN’s in
autologe CD4+-T-cellen afkomstig van hiv-patiënten,
die na reïnfusie een dalende hiv-bloedtiter tot gevolg
hadden bij de meerderheid van de patiënten.38 Deze
studie laat zien dat het mogelijk is om genen te modificeren met recombinante eiwitten, in primaire humane
cellen, deze terug te plaatsen in patiënten, zonder
nadelige bijeffecten, met een gunstig resultaat tot gevolg.
In een klinische studie die recentelijk is aangemeld
wordt CRISPR/Cas9 ingezet om T-cellen, geïsoleerd uit
een panel van 18 patiënten die leiden aan myeloom,
sarcoom en melanoom, genetisch te modificeren, waarna
deze gemodificeerde cellen worden teruggeplaatst, zodat
deze effectiever tumoren kunnen bestrijden. In deze
studie zal ook nauw worden gekeken naar de mogelijke
nadelige effecten van het CRISPR/Cas9-systeem.39
CONCLUSIE
Het CRISPR/Cas-systeem heeft zich in het laboratorium
ontwikkeld tot een tweecomponentensysteem, namelijk
een endonuclease en een RNA-molecuul, om een specifieke sequentie te knippen. Het CRISPR/Cas-systeem
OVERZICHTSARTIKELEN
wordt nu ingezet, met Cas9 of gemodificeerde Caseiwitten met een alternatieve katalytische activiteit, voor
specifieke DNA-deletie, -insertie, -vervanging, -modificatie, -labeling, -transcriptiemodulatie, massagendataanalyse in verschillende celtypen en organismen. De
verbluffende eenvoud van het systeem om met hoge
specificiteit zelfs meerdere genen tegelijk te bewerken,
het zogenoemde multiplexing, maakt het CRISPR/Cassysteem zeer aantrekkelijk om mee te werken. Het is
een scalpel die met chirurgische precisie bijna overal in
het genoom kan knippen om een base te veranderen of
om hele genen erin te zetten. Inmiddels zijn de eerste
klinische studies in China en de Verenigde Staten
gestart.40 Deze studies zullen antwoord moeten geven
op belangrijke vragen die nog open staan met betrekking tot het gebruik van de CRISPR/Cas9-techniek bij
mensen. Is het veilig? Wat zijn de ongewilde mutaties
die mogelijk kunnen ontstaan in het menselijke genoom
en welk transfersysteem moet worden gebruikt om
de CRISPR/Cas9-componenten efficiënt en veilig in
menselijke cellen te krijgen?
Het CRISPR/Cas-systeem heeft een verdere aanzet
gegeven in het onderzoek naar de oorzaken van hematologische aandoeningen en het is te verwachten dat de
verdere ontwikkeling van het CRISPR/Cas-systeem zal
leiden tot een veilige vorm van gentherapie als behandeling van hematologische ziekten.
37
10. Ishino Y, Shinagawa H, Makino K, et al. Nucleotide sequence of the iap
gene, responsible for alkaline phosphatase isozyme conversion in Escherichia
coli, and identification of the gene product. J Bacteriol 1987;169(12):5429-33.
11. Bolotin A, Quinquis B, Sorokin A, et al. Clustered regularly interspaced short
palindrome repeats (CRISPRs) have spacers of extrachromosomal origin.
Microbiology 2005;151(Pt 8):2551-61.
12. Mojica FJ, Díez-Villaseñor C, García-Martínez J, et al. Intervening sequences
of regularly spaced prokaryotic repeats derive from foreign genetic elements.
J Mol Evol 2005;60(2):174-82.
13. Jansen R, Embden JD, Gaastra W, et al. Identification of genes that are
associated with DNA repeats in prokaryotes. Mol Microbiol 2002;43(6):1565-75.
14. Pourcel C, Salvignol G, Vergnaud G. CRISPR elements in Yersinia pestis
acquire new repeats by preferential uptake of bacteriophage DNA, and provide
additional tools for evolutionary studies. Microbiology 2005;151(Pt 3):653-63.
15. Makarova KS, Grishin NV, Shabalina SA, et al. A putative RNA-interferencebased immune system in prokaryotes: computational analysis of the predicted
enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical
mechanisms of action. Biol Direct 2006;1:7.
16. Wright AV, Nuñez JK, Doudna JA. Biology and applications of CRISPR
systems: harnessing nature’s toolbox for genome engineering. Cell 2016;164
(1-2):29-44.
17. Deltcheva E, Chylinski K, Sharma CM, et al. CRISPR RNA maturation by
trans-encoded small RNA and host factor RNase III. Nature 2011;471(7340):602-7.
18. Gasiunas G, Barrangou R, Horvath P, et al. Cas9-crRNA ribonucleoprotein
complex mediates specific DNA cleavage for adaptive immunity in bacteria.
Proc Natl Acad Sci USA 2012;109(39).
19. Ran FA, Hsu PD, Wright J, et al. Genome engineering using the CRISPRCas9 system. Nat Protoc 2013;(11):2281-308.
REFERENTIES
20. Adejumo OA, Malee KM, Ryscavage P, et al. Contemporary issues on
1. Doudna JA, Charpentier E. Genome editing. The new frontier of genome
the epidemiology and antiretroviral adherence of HIV-infected adolescents in
engineering with CRISPR-Cas9. Science 2014;346(6213):1077.
sub-Saharan Africa: a narrative review. J Int AIDS Soc 2015;18:20049.
2. Klug A. The discovery of zinc fingers and their development for practical
21. Kulpa DA, Chomont N. HIV persistence in the setting of antiretroviral therapy:
applications in gene regulation and genome manipulation. Q Rev Biophys
when, where and how does HIV hide? J Virus Erad 2015;1(2):59-66.
2010;43(1):1-21.
22. Kaminski R, Bella R, Yin C, et al. Excision of HIV-1 DNA by gene editing:
3. Sanjana NE, Cong L, Zhou Y, et al. A transcription activator-like effector toolbox
a proof-of-concept in vivo study. Gene Ther 2016;23(8-9):696.
for genome engineering. Nat Protoc 2012;7(1):171-92.
23. Mittermeyer G, Christine CW, Rosenbluth KH, et al. Long-term evaluation of
4. Jinek M, Chylinski K, Fonfara I, et al. A programmable dual-RNA-guided DNA
a phase 1 study of AADC gene therapy for Parkinson’s disease. Hum Gene Ther
endonuclease in adaptive bacterial immunity. Science 2012;337(6096):816-21.
2012;23(4):377-81.
5. Moore JK, Haber JE. Cell cycle and genetic requirements of two pathways of
24. Naldini L. Gene therapy returns to centre stage. Nature 2015;526(7573):351-60.
nonhomologous end-joining repair of double-strand breaks in Saccharomyces
25. Ran FA, Cong L, Yan WX, et al. In vivo genome editing using Staphylococcus
cerevisiae. Mol Cell Biol 1996;16(5):2164-73.
aureus Cas9. Nature 2015;520(7546):186-91.
6. Rong YS, Golic KG. Gene targeting by homologous recombination in Drosophila.
26. Canver MC, Orkin SH. Customizing the genome as therapy for the β-hemo-
Science 2000;288:2013-8.
globinopathies. Blood 2016;127(21):2536-45.
7. Smithies O, Gregg RG, Boggs SS, et al. Insertion of DNA sequences into the
27. Löwenberg B, Ossenkoppele G, De Witte T, et al. Handboek Hematologie.
human chromosomal beta-globin locus by homologous recombination. Nature
Uitgeverij de Tijdstroom, 2008.
1985;317(6034):230-4.
28. Takahashi K, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells
8. Barrangou R, Fremaux C, Deveau H, et al. CRISPR provides acquired resistance
from adult human fibroblasts by defined factors. Cell 2007;131(5):861-72.
against viruses in prokaryotes. Science 2007;315(5819):1709-12.
29. Kaufman DS. Toward clinical therapies using hematopoietic cells derived
9. Makarova KS, Wolf YI, Alkhnbashi OS, et al. An updated evolutionary classifi-
from human pluripotent stem cells. Blood 2009;114(17):3513-23.
cation of CRISPR-Cas systems. Nat Rev Microbiol 2015;13(11):722-36.
30. Slukvin II. Hematopoietic specification from human pluripotent stem cells:
1
JA A RG A NG14 J A N U A R I 2 017
38
OVERZICHTSARTIKELEN
current advances and challenges toward de novo generation of hematopoietic
from β-thalassemia fibroblasts allow efficient gene correction with CRISPR/
stem cells. Blood 2013;122(25):4035-46.
Cas9. Stem Cells Transl Med 2016;5(2):267.
31. Voit RA, Hendel A, Pruett-Miller SM, et al. Nuclease-mediated gene editing
36. Zhang N, Zhi H, Curtis BR, et al. CRISPR/Cas9-mediated conversion of
by homologous recombination of the human globin locus. Nucleic Acids Res
human platelet alloantigen allotypes. Blood 2016;127(6):675-80.
2014;42(2):1365-78.
37. Ding Q, Regan SN, Xia Y, et al. Enhanced efficiency of human pluripotent
32. Zou J, Mali P, Huang X, Dowey SN, et al. Site-specific gene correction of a
stem cell genome editing through replacing TALENs with CRISPRs. Cell Stem
point mutation in human iPS cells derived from an adult patient with sickle cell
Cell 2013;12(4):393-4.
disease. Blood 2011;118(17):4599-608.
38. Tebas P, Stein D, Tang WW, et al. Gene editing of CCR5 in autologous CD4
33. Huang X, Wang Y, Yan W, et al. Production of gene-corrected adult beta
T cells of persons infected with HIV. N Engl J Med 2014;370(10):901-10.
globin protein in human erythrocytes differentiated from patient iPSCs after
39. http://www.sciencemag.org/news/2016/06/human-crispr-trial-proposed.
genome editing of the sickle point mutation. Stem Cells 2015;33(5):1470-9.
40. Cyranoski D. Chinese scientists to pioneer first human CRISPR trial. Nature
34. Song B, Fan Y, He W, et al. Improved hematopoietic differentiation efficiency
2016;535(7613):476-7.
of gene-corrected beta-thalassemia induced pluripotent stem cells by CRISPR/
Cas9 system. Stem Cells Dev 2015;24(9):1053-65.
35. Yang Y, Zhang X, Yi L, et al. Naïve induced pluripotent stem cells generated
JA A RG A NG14 J A N U A R I 2 017
ONTVANGEN 2 AUGUSTUS 2016, GEACCEPTEERD 21 NOVEMBER 2016.
Download
Random flashcards
Rekenen

3 Cards Patricia van Oirschot

Create flashcards